Incidental Mutation 'R8057:Tns3'
ID619464
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Nametensin 3
SynonymsTEM6, F830010I22Rik, Tens1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R8057 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location8431652-8664535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 8492773 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 530 (A530G)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
Predicted Effect probably benign
Transcript: ENSMUST00000020695
AA Change: A530G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: A530G

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik C T 16: 8,830,368 probably benign Het
4930523C07Rik T C 1: 160,075,256 L32P probably damaging Het
4930563M21Rik T C 9: 56,009,280 T38A unknown Het
Abcb6 T C 1: 75,174,358 N563D probably damaging Het
Ak4 T C 4: 101,460,653 F140S probably damaging Het
Arhgap27 T A 11: 103,338,693 R296S probably damaging Het
Atxn7l1 A C 12: 33,326,002 K98N probably damaging Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Camta1 T C 4: 151,144,032 D781G probably damaging Het
Capn7 A G 14: 31,370,979 D800G probably benign Het
Carmil2 G A 8: 105,692,376 V716I probably benign Het
Cdk5 C A 5: 24,420,784 D144Y probably damaging Het
Chd5 T A 4: 152,366,372 L651Q probably damaging Het
Clcn7 C T 17: 25,149,259 Q261* probably null Het
Cntnap2 T A 6: 46,347,145 F576Y probably damaging Het
Col11a1 G A 3: 114,131,614 G815D unknown Het
Col4a4 T A 1: 82,523,870 R387S unknown Het
Cse1l T A 2: 166,939,925 V663D probably damaging Het
Csf2rb2 G T 15: 78,285,006 Q650K probably damaging Het
Ctnnd2 A G 15: 30,847,351 D696G possibly damaging Het
D17Wsu92e C T 17: 27,767,889 A288T unknown Het
Dnah7c T A 1: 46,688,952 C2937S possibly damaging Het
Epha10 A T 4: 124,902,683 Q395L Het
Fam167a T A 14: 63,452,320 V22E probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabra4 A G 5: 71,623,952 I372T probably benign Het
Gm3550 T C 18: 34,737,529 F39L probably damaging Het
Gpt A G 15: 76,696,772 probably benign Het
H2-K1 C T 17: 33,996,859 G336D possibly damaging Het
Hoxd8 T C 2: 74,704,726 probably null Het
Kdm5d T G Y: 927,355 D658E possibly damaging Het
Krt25 G A 11: 99,317,343 T353M probably benign Het
Lonp2 T C 8: 86,714,089 L778P probably damaging Het
Lrrc66 G A 5: 73,607,532 Q723* probably null Het
Mak T A 13: 41,049,337 I212F probably damaging Het
Mastl T A 2: 23,133,554 R386W possibly damaging Het
Mis18bp1 A G 12: 65,148,899 I697T possibly damaging Het
Nek5 G A 8: 22,088,906 T415I probably benign Het
Neu3 T A 7: 99,814,228 N96I probably benign Het
Nxph2 T C 2: 23,400,095 V153A possibly damaging Het
Odf3l2 T A 10: 79,640,001 H243L probably damaging Het
Olfr1454 G A 19: 13,063,274 probably benign Het
Olfr518 A T 7: 108,881,364 F81I probably damaging Het
Olfr878 A G 9: 37,919,164 D169G probably benign Het
Otogl T C 10: 107,808,615 T1257A probably benign Het
Pcdh10 G A 3: 45,379,259 V3M probably benign Het
Pitpnm1 G A 19: 4,112,145 R1017Q probably null Het
Plcb3 A C 19: 6,955,095 H1065Q probably benign Het
Plcb3 A T 19: 6,958,899 M752K probably damaging Het
Plch1 T C 3: 63,698,136 E1449G probably benign Het
Plekha4 T A 7: 45,549,271 C573S probably benign Het
Plin2 T C 4: 86,657,401 I304V possibly damaging Het
Pnp2 G A 14: 50,964,381 V275I probably benign Het
Polr1a G A 6: 71,931,660 A490T possibly damaging Het
Ppp1r12b A G 1: 134,955,616 F56S probably damaging Het
Ptk2 GA G 15: 73,298,199 probably null Het
Rb1cc1 C A 1: 6,245,219 R473S probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx T C 9: 52,065,646 V65A probably damaging Het
Rps6ka5 A G 12: 100,573,796 probably null Het
Samd5 C T 10: 9,674,897 V23M probably damaging Het
Scn9a T G 2: 66,515,430 R1117S probably benign Het
Scrn1 T A 6: 54,520,773 I278L probably benign Het
Sec31b G T 19: 44,519,365 P747T probably damaging Het
Sipa1l2 A T 8: 125,468,530 V823E probably damaging Het
Slc2a13 T C 15: 91,516,416 N201S probably damaging Het
Snx31 C A 15: 36,523,460 V359F probably damaging Het
Sstr2 A G 11: 113,624,273 E6G probably benign Het
Stc2 C A 11: 31,367,806 E72* probably null Het
Tead1 C T 7: 112,759,514 P11L probably benign Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tmem63c A T 12: 87,072,198 K301* probably null Het
Trat1 T C 16: 48,742,237 D70G probably damaging Het
Trex1 T A 9: 109,058,329 E198V probably damaging Het
Ttn T G 2: 76,739,728 R26940S probably damaging Het
Uba2 T C 7: 34,168,410 K34R possibly damaging Het
Vps13d A C 4: 144,975,183 M4376R Het
Zfp157 C A 5: 138,456,074 T178K probably damaging Het
Zfp318 T A 17: 46,399,766 V805D possibly damaging Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8451066 missense probably benign 0.42
IGL00822:Tns3 APN 11 8443976 missense probably damaging 0.99
IGL01075:Tns3 APN 11 8478399 missense probably benign 0.45
IGL01286:Tns3 APN 11 8492617 missense probably benign 0.01
IGL01680:Tns3 APN 11 8548937 missense probably damaging 1.00
IGL01687:Tns3 APN 11 8492798 missense probably damaging 1.00
IGL01734:Tns3 APN 11 8519192 splice site probably benign
IGL01844:Tns3 APN 11 8437177 missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8548992 nonsense probably null
IGL02137:Tns3 APN 11 8492578 missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8434531 missense probably damaging 1.00
IGL02623:Tns3 APN 11 8437141 missense probably damaging 1.00
IGL02697:Tns3 APN 11 8492346 missense probably benign 0.00
IGL02829:Tns3 APN 11 8519564 missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8492149 missense probably benign 0.38
R0020:Tns3 UTSW 11 8545227 critical splice donor site probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0370:Tns3 UTSW 11 8445730 missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8445703 missense probably benign 0.07
R0410:Tns3 UTSW 11 8435852 missense probably benign 0.02
R0496:Tns3 UTSW 11 8547262 splice site probably benign
R0562:Tns3 UTSW 11 8493262 missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8493121 missense probably benign 0.04
R0736:Tns3 UTSW 11 8519474 missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8493302 missense probably damaging 1.00
R1367:Tns3 UTSW 11 8448704 missense probably benign 0.01
R1386:Tns3 UTSW 11 8518261 missense probably benign 0.02
R1975:Tns3 UTSW 11 8435738 missense probably benign 0.04
R2205:Tns3 UTSW 11 8531719 missense probably damaging 1.00
R2319:Tns3 UTSW 11 8541200 missense probably damaging 1.00
R2830:Tns3 UTSW 11 8435870 missense probably damaging 1.00
R3720:Tns3 UTSW 11 8492999 missense probably damaging 1.00
R3765:Tns3 UTSW 11 8451133 missense probably benign 0.00
R3817:Tns3 UTSW 11 8434619 missense probably damaging 1.00
R4058:Tns3 UTSW 11 8492275 missense probably damaging 1.00
R4599:Tns3 UTSW 11 8531747 missense probably damaging 1.00
R4631:Tns3 UTSW 11 8451119 missense probably benign 0.30
R4731:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4732:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4733:Tns3 UTSW 11 8450986 missense probably benign 0.28
R5472:Tns3 UTSW 11 8451092 missense probably benign
R5749:Tns3 UTSW 11 8451177 missense probably benign 0.01
R5807:Tns3 UTSW 11 8493211 missense probably damaging 1.00
R5844:Tns3 UTSW 11 8434580 missense probably damaging 1.00
R5942:Tns3 UTSW 11 8435860 missense probably damaging 1.00
R5982:Tns3 UTSW 11 8492245 missense probably damaging 0.99
R6025:Tns3 UTSW 11 8492578 missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8492987 missense probably damaging 1.00
R6322:Tns3 UTSW 11 8492147 missense probably benign 0.01
R6536:Tns3 UTSW 11 8434531 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549057 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549058 missense probably damaging 1.00
R6864:Tns3 UTSW 11 8493196 missense probably damaging 1.00
R6897:Tns3 UTSW 11 8531743 missense probably damaging 1.00
R7108:Tns3 UTSW 11 8437251 missense probably benign 0.00
R7443:Tns3 UTSW 11 8451442 missense probably benign 0.01
R7459:Tns3 UTSW 11 8492793 missense probably benign 0.16
R7474:Tns3 UTSW 11 8530894 missense probably damaging 1.00
R7576:Tns3 UTSW 11 8541192 missense possibly damaging 0.78
R8055:Tns3 UTSW 11 8545343 missense probably damaging 1.00
T0975:Tns3 UTSW 11 8451146 missense probably benign 0.00
T0975:Tns3 UTSW 11 8479518 missense probably benign
T0975:Tns3 UTSW 11 8549100 start gained probably benign
X0005:Tns3 UTSW 11 8451224 missense probably benign 0.00
X0005:Tns3 UTSW 11 8479518 missense probably benign
Z1177:Tns3 UTSW 11 8451014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGGCAAAGCTGTACTGGTG -3'
(R):5'- GACCGGGAGACTGACATTCTAG -3'

Sequencing Primer
(F):5'- ATCTGCTGCTGACGTACCCAAG -3'
(R):5'- GACATTCTAGATGATGAGATGCCCC -3'
Posted On2020-01-23