Incidental Mutation 'R8057:Rps6ka5'
ID619472
Institutional Source Beutler Lab
Gene Symbol Rps6ka5
Ensembl Gene ENSMUSG00000021180
Gene Nameribosomal protein S6 kinase, polypeptide 5
Synonyms6330404E13Rik, MSK1, 3110005L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8057 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location100548439-100726983 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 100573796 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043599] [ENSMUST00000222731]
Predicted Effect probably null
Transcript: ENSMUST00000043599
SMART Domains Protein: ENSMUSP00000042987
Gene: ENSMUSG00000021180

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
S_TKc 48 317 1.08e-101 SMART
S_TK_X 318 378 2.45e-13 SMART
S_TKc 425 751 1.1e-75 SMART
low complexity region 812 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221356
Predicted Effect probably benign
Transcript: ENSMUST00000222731
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (81/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutant allele exhibit altered response to cocaine including decreased hyperlocomotor activity and sensitization at a lower dose. Mice homozygous for a kinase dead allele exhibit altered experience-dependent synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik C T 16: 8,830,368 probably benign Het
4930523C07Rik T C 1: 160,075,256 L32P probably damaging Het
4930563M21Rik T C 9: 56,009,280 T38A unknown Het
Abcb6 T C 1: 75,174,358 N563D probably damaging Het
Ak4 T C 4: 101,460,653 F140S probably damaging Het
Arhgap27 T A 11: 103,338,693 R296S probably damaging Het
Atxn7l1 A C 12: 33,326,002 K98N probably damaging Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Camta1 T C 4: 151,144,032 D781G probably damaging Het
Capn7 A G 14: 31,370,979 D800G probably benign Het
Carmil2 G A 8: 105,692,376 V716I probably benign Het
Cdk5 C A 5: 24,420,784 D144Y probably damaging Het
Cep85 T C 4: 134,153,614 probably benign Het
Chd5 T A 4: 152,366,372 L651Q probably damaging Het
Clcn7 C T 17: 25,149,259 Q261* probably null Het
Cntnap2 T A 6: 46,347,145 F576Y probably damaging Het
Col11a1 G A 3: 114,131,614 G815D unknown Het
Col4a4 T A 1: 82,523,870 R387S unknown Het
Cse1l T A 2: 166,939,925 V663D probably damaging Het
Csf2rb2 G T 15: 78,285,006 Q650K probably damaging Het
Ctnnd2 A G 15: 30,847,351 D696G possibly damaging Het
D17Wsu92e C T 17: 27,767,889 A288T unknown Het
Dnah7c T A 1: 46,688,952 C2937S possibly damaging Het
Epha10 A T 4: 124,902,683 Q395L Het
Fam167a T A 14: 63,452,320 V22E probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabra4 A G 5: 71,623,952 I372T probably benign Het
Gm3550 T C 18: 34,737,529 F39L probably damaging Het
Gpt A G 15: 76,696,772 probably benign Het
H2-K1 C T 17: 33,996,859 G336D possibly damaging Het
Hoxd8 T C 2: 74,704,726 probably null Het
Kdm5d T G Y: 927,355 D658E possibly damaging Het
Krt25 G A 11: 99,317,343 T353M probably benign Het
Lonp2 T C 8: 86,714,089 L778P probably damaging Het
Lrrc66 G A 5: 73,607,532 Q723* probably null Het
Mak T A 13: 41,049,337 I212F probably damaging Het
Mastl T A 2: 23,133,554 R386W possibly damaging Het
Mis18bp1 A G 12: 65,148,899 I697T possibly damaging Het
Nek5 G A 8: 22,088,906 T415I probably benign Het
Neu3 T A 7: 99,814,228 N96I probably benign Het
Nxph2 T C 2: 23,400,095 V153A possibly damaging Het
Odf3l2 T A 10: 79,640,001 H243L probably damaging Het
Olfr1454 G A 19: 13,063,274 probably benign Het
Olfr518 A T 7: 108,881,364 F81I probably damaging Het
Olfr878 A G 9: 37,919,164 D169G probably benign Het
Otogl T C 10: 107,808,615 T1257A probably benign Het
Pcdh10 G A 3: 45,379,259 V3M probably benign Het
Pitpnm1 G A 19: 4,112,145 R1017Q probably null Het
Plcb3 A C 19: 6,955,095 H1065Q probably benign Het
Plcb3 A T 19: 6,958,899 M752K probably damaging Het
Plch1 T C 3: 63,698,136 E1449G probably benign Het
Plekha4 T A 7: 45,549,271 C573S probably benign Het
Plin2 T C 4: 86,657,401 I304V possibly damaging Het
Pnp2 G A 14: 50,964,381 V275I probably benign Het
Polr1a G A 6: 71,931,660 A490T possibly damaging Het
Ppp1r12b A G 1: 134,955,616 F56S probably damaging Het
Ptk2 GA G 15: 73,298,199 probably null Het
Rb1cc1 C A 1: 6,245,219 R473S probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx T C 9: 52,065,646 V65A probably damaging Het
Samd5 C T 10: 9,674,897 V23M probably damaging Het
Scn9a T G 2: 66,515,430 R1117S probably benign Het
Scrn1 T A 6: 54,520,773 I278L probably benign Het
Sec31b G T 19: 44,519,365 P747T probably damaging Het
Sipa1l2 A T 8: 125,468,530 V823E probably damaging Het
Slc2a13 T C 15: 91,516,416 N201S probably damaging Het
Slc30a3 C A 5: 31,090,051 probably benign Het
Snx31 C A 15: 36,523,460 V359F probably damaging Het
Sstr2 A G 11: 113,624,273 E6G probably benign Het
Stc2 C A 11: 31,367,806 E72* probably null Het
Tead1 C T 7: 112,759,514 P11L probably benign Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tmem63c A T 12: 87,072,198 K301* probably null Het
Tns3 G C 11: 8,492,773 A530G probably benign Het
Trat1 T C 16: 48,742,237 D70G probably damaging Het
Trex1 T A 9: 109,058,329 E198V probably damaging Het
Ttn T G 2: 76,739,728 R26940S probably damaging Het
Uba2 T C 7: 34,168,410 K34R possibly damaging Het
Vps13d A C 4: 144,975,183 M4376R Het
Zfp157 C A 5: 138,456,074 T178K probably damaging Het
Zfp318 T A 17: 46,399,766 V805D possibly damaging Het
Other mutations in Rps6ka5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Rps6ka5 APN 12 100573898 missense probably benign
IGL01450:Rps6ka5 APN 12 100552991 splice site probably benign
IGL01586:Rps6ka5 APN 12 100570914 missense probably damaging 0.99
IGL01743:Rps6ka5 APN 12 100575633 critical splice donor site probably null
IGL02995:Rps6ka5 APN 12 100573999 intron probably benign
IGL03051:Rps6ka5 APN 12 100615991 splice site probably null
IGL03190:Rps6ka5 APN 12 100558648 splice site probably benign
chard UTSW 12 100616083 missense probably damaging 1.00
Ramp UTSW 12 100575705 missense possibly damaging 0.85
zwiebel UTSW 12 100678538 missense probably damaging 0.99
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0067:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R0212:Rps6ka5 UTSW 12 100553169 splice site probably null
R0761:Rps6ka5 UTSW 12 100570882 missense probably damaging 1.00
R0893:Rps6ka5 UTSW 12 100574438 missense possibly damaging 0.71
R1237:Rps6ka5 UTSW 12 100575705 missense possibly damaging 0.85
R1254:Rps6ka5 UTSW 12 100619529 missense probably damaging 1.00
R1447:Rps6ka5 UTSW 12 100577825 missense probably benign 0.02
R1611:Rps6ka5 UTSW 12 100570852 missense possibly damaging 0.77
R2086:Rps6ka5 UTSW 12 100619615 missense possibly damaging 0.67
R2129:Rps6ka5 UTSW 12 100678538 missense probably damaging 0.99
R2298:Rps6ka5 UTSW 12 100551454 missense probably damaging 0.99
R2432:Rps6ka5 UTSW 12 100554405 missense probably damaging 0.98
R4378:Rps6ka5 UTSW 12 100597937 missense probably damaging 1.00
R4394:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4461:Rps6ka5 UTSW 12 100570864 missense probably damaging 0.99
R4584:Rps6ka5 UTSW 12 100581318 missense probably damaging 1.00
R4672:Rps6ka5 UTSW 12 100654287 missense possibly damaging 0.93
R4706:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4706:Rps6ka5 UTSW 12 100597885 splice site probably null
R4707:Rps6ka5 UTSW 12 100597885 splice site probably null
R4966:Rps6ka5 UTSW 12 100553066 missense probably benign 0.01
R5059:Rps6ka5 UTSW 12 100554375 missense probably damaging 0.96
R5404:Rps6ka5 UTSW 12 100616093 missense probably damaging 1.00
R5660:Rps6ka5 UTSW 12 100619580 missense possibly damaging 0.95
R5678:Rps6ka5 UTSW 12 100724876 missense unknown
R5992:Rps6ka5 UTSW 12 100575250 missense possibly damaging 0.68
R6104:Rps6ka5 UTSW 12 100553148 missense possibly damaging 0.84
R6163:Rps6ka5 UTSW 12 100595920 critical splice acceptor site probably null
R6390:Rps6ka5 UTSW 12 100570992 missense probably damaging 0.99
R6599:Rps6ka5 UTSW 12 100597909 missense probably damaging 1.00
R6653:Rps6ka5 UTSW 12 100551536 missense probably damaging 1.00
R6693:Rps6ka5 UTSW 12 100573829 missense probably benign 0.11
R7009:Rps6ka5 UTSW 12 100619537 missense probably damaging 1.00
R7157:Rps6ka5 UTSW 12 100581420 missense probably damaging 1.00
R7196:Rps6ka5 UTSW 12 100595864 missense possibly damaging 0.77
R7510:Rps6ka5 UTSW 12 100616068 missense possibly damaging 0.56
R7565:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R7800:Rps6ka5 UTSW 12 100558565 missense probably damaging 0.97
R7843:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R8009:Rps6ka5 UTSW 12 100577789 missense probably damaging 0.97
R8292:Rps6ka5 UTSW 12 100678532 missense possibly damaging 0.83
R8324:Rps6ka5 UTSW 12 100558487 missense possibly damaging 0.92
R8428:Rps6ka5 UTSW 12 100575241 nonsense probably null
R8913:Rps6ka5 UTSW 12 100554336 missense
Predicted Primers PCR Primer
(F):5'- TGAGTCCCAAAAGCTACTCTAGTC -3'
(R):5'- GGACAGGTTGTTCTATGCTCTC -3'

Sequencing Primer
(F):5'- AGCTACTCTAGTCAAGAATGTCAC -3'
(R):5'- ACAGGTTGTTCTATGCTCTCTTCTAC -3'
Posted On2020-01-23