Incidental Mutation 'R8057:Ptk2'
ID619479
Institutional Source Beutler Lab
Gene Symbol Ptk2
Ensembl Gene ENSMUSG00000022607
Gene NamePTK2 protein tyrosine kinase 2
SynonymsFRNK, FAK, Fadk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8057 (G1)
Quality Score217.468
Status Not validated
Chromosome15
Chromosomal Location73205102-73423280 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GA to G at 73298199 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]
Predicted Effect probably null
Transcript: ENSMUST00000110036
SMART Domains Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 288 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Pfam:Focal_AT 914 1046 5e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226988
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik C T 16: 8,830,368 probably benign Het
4930523C07Rik T C 1: 160,075,256 L32P probably damaging Het
4930563M21Rik T C 9: 56,009,280 T38A unknown Het
Abcb6 T C 1: 75,174,358 N563D probably damaging Het
Ak4 T C 4: 101,460,653 F140S probably damaging Het
Arhgap27 T A 11: 103,338,693 R296S probably damaging Het
Atxn7l1 A C 12: 33,326,002 K98N probably damaging Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Camta1 T C 4: 151,144,032 D781G probably damaging Het
Capn7 A G 14: 31,370,979 D800G probably benign Het
Carmil2 G A 8: 105,692,376 V716I probably benign Het
Cdk5 C A 5: 24,420,784 D144Y probably damaging Het
Chd5 T A 4: 152,366,372 L651Q probably damaging Het
Clcn7 C T 17: 25,149,259 Q261* probably null Het
Cntnap2 T A 6: 46,347,145 F576Y probably damaging Het
Col11a1 G A 3: 114,131,614 G815D unknown Het
Col4a4 T A 1: 82,523,870 R387S unknown Het
Cse1l T A 2: 166,939,925 V663D probably damaging Het
Csf2rb2 G T 15: 78,285,006 Q650K probably damaging Het
Ctnnd2 A G 15: 30,847,351 D696G possibly damaging Het
D17Wsu92e C T 17: 27,767,889 A288T unknown Het
Dnah7c T A 1: 46,688,952 C2937S possibly damaging Het
Epha10 A T 4: 124,902,683 Q395L Het
Fam167a T A 14: 63,452,320 V22E probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabra4 A G 5: 71,623,952 I372T probably benign Het
Gm3550 T C 18: 34,737,529 F39L probably damaging Het
Gpt A G 15: 76,696,772 probably benign Het
H2-K1 C T 17: 33,996,859 G336D possibly damaging Het
Hoxd8 T C 2: 74,704,726 probably null Het
Kdm5d T G Y: 927,355 D658E possibly damaging Het
Krt25 G A 11: 99,317,343 T353M probably benign Het
Lonp2 T C 8: 86,714,089 L778P probably damaging Het
Lrrc66 G A 5: 73,607,532 Q723* probably null Het
Mak T A 13: 41,049,337 I212F probably damaging Het
Mastl T A 2: 23,133,554 R386W possibly damaging Het
Mis18bp1 A G 12: 65,148,899 I697T possibly damaging Het
Nek5 G A 8: 22,088,906 T415I probably benign Het
Neu3 T A 7: 99,814,228 N96I probably benign Het
Nxph2 T C 2: 23,400,095 V153A possibly damaging Het
Odf3l2 T A 10: 79,640,001 H243L probably damaging Het
Olfr1454 G A 19: 13,063,274 probably benign Het
Olfr518 A T 7: 108,881,364 F81I probably damaging Het
Olfr878 A G 9: 37,919,164 D169G probably benign Het
Otogl T C 10: 107,808,615 T1257A probably benign Het
Pcdh10 G A 3: 45,379,259 V3M probably benign Het
Pitpnm1 G A 19: 4,112,145 R1017Q probably null Het
Plcb3 A C 19: 6,955,095 H1065Q probably benign Het
Plcb3 A T 19: 6,958,899 M752K probably damaging Het
Plch1 T C 3: 63,698,136 E1449G probably benign Het
Plekha4 T A 7: 45,549,271 C573S probably benign Het
Plin2 T C 4: 86,657,401 I304V possibly damaging Het
Pnp2 G A 14: 50,964,381 V275I probably benign Het
Polr1a G A 6: 71,931,660 A490T possibly damaging Het
Ppp1r12b A G 1: 134,955,616 F56S probably damaging Het
Rb1cc1 C A 1: 6,245,219 R473S probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx T C 9: 52,065,646 V65A probably damaging Het
Rps6ka5 A G 12: 100,573,796 probably null Het
Samd5 C T 10: 9,674,897 V23M probably damaging Het
Scn9a T G 2: 66,515,430 R1117S probably benign Het
Scrn1 T A 6: 54,520,773 I278L probably benign Het
Sec31b G T 19: 44,519,365 P747T probably damaging Het
Sipa1l2 A T 8: 125,468,530 V823E probably damaging Het
Slc2a13 T C 15: 91,516,416 N201S probably damaging Het
Snx31 C A 15: 36,523,460 V359F probably damaging Het
Sstr2 A G 11: 113,624,273 E6G probably benign Het
Stc2 C A 11: 31,367,806 E72* probably null Het
Tead1 C T 7: 112,759,514 P11L probably benign Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tmem63c A T 12: 87,072,198 K301* probably null Het
Tns3 G C 11: 8,492,773 A530G probably benign Het
Trat1 T C 16: 48,742,237 D70G probably damaging Het
Trex1 T A 9: 109,058,329 E198V probably damaging Het
Ttn T G 2: 76,739,728 R26940S probably damaging Het
Uba2 T C 7: 34,168,410 K34R possibly damaging Het
Vps13d A C 4: 144,975,183 M4376R Het
Zfp157 C A 5: 138,456,074 T178K probably damaging Het
Zfp318 T A 17: 46,399,766 V805D possibly damaging Het
Other mutations in Ptk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Ptk2 APN 15 73262547 missense probably damaging 1.00
IGL00913:Ptk2 APN 15 73295389 splice site probably benign
IGL01605:Ptk2 APN 15 73264339 splice site probably benign
IGL01631:Ptk2 APN 15 73216371 missense probably damaging 1.00
IGL01952:Ptk2 APN 15 73229931 missense probably damaging 0.99
IGL01957:Ptk2 APN 15 73242473 missense probably benign 0.05
IGL02441:Ptk2 APN 15 73320826 missense probably benign 0.16
IGL02471:Ptk2 APN 15 73298187 missense probably benign 0.41
IGL02621:Ptk2 APN 15 73206145 missense probably damaging 0.99
IGL03198:Ptk2 APN 15 73236216 missense probably damaging 1.00
Shooter UTSW 15 73304444 missense possibly damaging 0.83
R0239:Ptk2 UTSW 15 73343283 unclassified probably null
R0239:Ptk2 UTSW 15 73343283 unclassified probably null
R1254:Ptk2 UTSW 15 73229970 missense probably benign 0.01
R1291:Ptk2 UTSW 15 73210756 missense probably damaging 1.00
R1307:Ptk2 UTSW 15 73292046 missense probably benign 0.01
R1608:Ptk2 UTSW 15 73262575 missense probably damaging 0.98
R1690:Ptk2 UTSW 15 73262610 missense probably damaging 1.00
R1724:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1725:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1740:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1741:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1840:Ptk2 UTSW 15 73210884 missense probably damaging 1.00
R1956:Ptk2 UTSW 15 73215983 missense possibly damaging 0.49
R2022:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2092:Ptk2 UTSW 15 73236191 nonsense probably null
R2114:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2115:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2336:Ptk2 UTSW 15 73266116 missense probably damaging 1.00
R2571:Ptk2 UTSW 15 73231919 missense probably damaging 1.00
R4232:Ptk2 UTSW 15 73309849 missense possibly damaging 0.61
R4245:Ptk2 UTSW 15 73231976 missense probably benign 0.00
R4594:Ptk2 UTSW 15 73206196 missense probably damaging 1.00
R4688:Ptk2 UTSW 15 73206225 missense probably damaging 1.00
R4834:Ptk2 UTSW 15 73216096 splice site probably null
R4847:Ptk2 UTSW 15 73231956 missense probably benign
R5558:Ptk2 UTSW 15 73304445 missense probably damaging 0.97
R5682:Ptk2 UTSW 15 73262564 nonsense probably null
R5858:Ptk2 UTSW 15 73321095 missense probably benign 0.12
R5951:Ptk2 UTSW 15 73303833 missense possibly damaging 0.88
R6014:Ptk2 UTSW 15 73304444 missense possibly damaging 0.83
R6027:Ptk2 UTSW 15 73229913 missense probably damaging 1.00
R6082:Ptk2 UTSW 15 73276865 missense probably damaging 1.00
R7025:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7031:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7032:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7077:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7078:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7079:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7090:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7091:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7092:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7136:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7137:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7798:Ptk2 UTSW 15 73295375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACACTTCATCTTTATCCCAGAG -3'
(R):5'- CCTGACTCTTAAGGCTCTTGAG -3'

Sequencing Primer
(F):5'- ACTTCATCTTTATCCCAGAGAAGTC -3'
(R):5'- GACTCTTAAGGCTCTTGAGAATAGGC -3'
Posted On2020-01-23