Mutagenetix > Incidental Mutations

Incidental Mutation 'R8057:Ptk2'

619479

Institutional Source

Beutler Lab

Gene Symbol

Ptk2

Ensembl Gene

ENSMUSG00000022607

Gene Name

PTK2 protein tyrosine kinase 2

Synonyms

FRNK, FAK, Fadk

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8057 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

73205102-73423280 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GA to G at 73298199 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]

Predicted Effect

probably null
Transcript: ENSMUST00000110036

SMART Domains

Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	288	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC
Pfam:Focal_AT	914	1046	5e-59	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000226988

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	C	T	16: 8,830,368		probably benign	Het
4930523C07Rik	T	C	1: 160,075,256	L32P	probably damaging	Het
4930563M21Rik	T	C	9: 56,009,280	T38A	unknown	Het
Abcb6	T	C	1: 75,174,358	N563D	probably damaging	Het
Ak4	T	C	4: 101,460,653	F140S	probably damaging	Het
Arhgap27	T	A	11: 103,338,693	R296S	probably damaging	Het
Atxn7l1	A	C	12: 33,326,002	K98N	probably damaging	Het
Bex6	G	T	16: 32,186,406	D11Y	probably damaging	Het
Camta1	T	C	4: 151,144,032	D781G	probably damaging	Het
Capn7	A	G	14: 31,370,979	D800G	probably benign	Het
Carmil2	G	A	8: 105,692,376	V716I	probably benign	Het
Cdk5	C	A	5: 24,420,784	D144Y	probably damaging	Het
Chd5	T	A	4: 152,366,372	L651Q	probably damaging	Het
Clcn7	C	T	17: 25,149,259	Q261*	probably null	Het
Cntnap2	T	A	6: 46,347,145	F576Y	probably damaging	Het
Col11a1	G	A	3: 114,131,614	G815D	unknown	Het
Col4a4	T	A	1: 82,523,870	R387S	unknown	Het
Cse1l	T	A	2: 166,939,925	V663D	probably damaging	Het
Csf2rb2	G	T	15: 78,285,006	Q650K	probably damaging	Het
Ctnnd2	A	G	15: 30,847,351	D696G	possibly damaging	Het
D17Wsu92e	C	T	17: 27,767,889	A288T	unknown	Het
Dnah7c	T	A	1: 46,688,952	C2937S	possibly damaging	Het
Epha10	A	T	4: 124,902,683	Q395L		Het
Fam167a	T	A	14: 63,452,320	V22E	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gabra4	A	G	5: 71,623,952	I372T	probably benign	Het
Gm3550	T	C	18: 34,737,529	F39L	probably damaging	Het
Gpt	A	G	15: 76,696,772		probably benign	Het
H2-K1	C	T	17: 33,996,859	G336D	possibly damaging	Het
Hoxd8	T	C	2: 74,704,726		probably null	Het
Kdm5d	T	G	Y: 927,355	D658E	possibly damaging	Het
Krt25	G	A	11: 99,317,343	T353M	probably benign	Het
Lonp2	T	C	8: 86,714,089	L778P	probably damaging	Het
Lrrc66	G	A	5: 73,607,532	Q723*	probably null	Het
Mak	T	A	13: 41,049,337	I212F	probably damaging	Het
Mastl	T	A	2: 23,133,554	R386W	possibly damaging	Het
Mis18bp1	A	G	12: 65,148,899	I697T	possibly damaging	Het
Nek5	G	A	8: 22,088,906	T415I	probably benign	Het
Neu3	T	A	7: 99,814,228	N96I	probably benign	Het
Nxph2	T	C	2: 23,400,095	V153A	possibly damaging	Het
Odf3l2	T	A	10: 79,640,001	H243L	probably damaging	Het
Olfr1454	G	A	19: 13,063,274		probably benign	Het
Olfr518	A	T	7: 108,881,364	F81I	probably damaging	Het
Olfr878	A	G	9: 37,919,164	D169G	probably benign	Het
Otogl	T	C	10: 107,808,615	T1257A	probably benign	Het
Pcdh10	G	A	3: 45,379,259	V3M	probably benign	Het
Pitpnm1	G	A	19: 4,112,145	R1017Q	probably null	Het
Plcb3	A	C	19: 6,955,095	H1065Q	probably benign	Het
Plcb3	A	T	19: 6,958,899	M752K	probably damaging	Het
Plch1	T	C	3: 63,698,136	E1449G	probably benign	Het
Plekha4	T	A	7: 45,549,271	C573S	probably benign	Het
Plin2	T	C	4: 86,657,401	I304V	possibly damaging	Het
Pnp2	G	A	14: 50,964,381	V275I	probably benign	Het
Polr1a	G	A	6: 71,931,660	A490T	possibly damaging	Het
Ppp1r12b	A	G	1: 134,955,616	F56S	probably damaging	Het
Rb1cc1	C	A	1: 6,245,219	R473S	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Het
Rdx	T	C	9: 52,065,646	V65A	probably damaging	Het
Rps6ka5	A	G	12: 100,573,796		probably null	Het
Samd5	C	T	10: 9,674,897	V23M	probably damaging	Het
Scn9a	T	G	2: 66,515,430	R1117S	probably benign	Het
Scrn1	T	A	6: 54,520,773	I278L	probably benign	Het
Sec31b	G	T	19: 44,519,365	P747T	probably damaging	Het
Sipa1l2	A	T	8: 125,468,530	V823E	probably damaging	Het
Slc2a13	T	C	15: 91,516,416	N201S	probably damaging	Het
Snx31	C	A	15: 36,523,460	V359F	probably damaging	Het
Sstr2	A	G	11: 113,624,273	E6G	probably benign	Het
Stc2	C	A	11: 31,367,806	E72*	probably null	Het
Tead1	C	T	7: 112,759,514	P11L	probably benign	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tmem63c	A	T	12: 87,072,198	K301*	probably null	Het
Tns3	G	C	11: 8,492,773	A530G	probably benign	Het
Trat1	T	C	16: 48,742,237	D70G	probably damaging	Het
Trex1	T	A	9: 109,058,329	E198V	probably damaging	Het
Ttn	T	G	2: 76,739,728	R26940S	probably damaging	Het
Uba2	T	C	7: 34,168,410	K34R	possibly damaging	Het
Vps13d	A	C	4: 144,975,183	M4376R		Het
Zfp157	C	A	5: 138,456,074	T178K	probably damaging	Het
Zfp318	T	A	17: 46,399,766	V805D	possibly damaging	Het

Other mutations in Ptk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Ptk2	APN	15	73262547	missense	probably damaging	1.00
IGL00913:Ptk2	APN	15	73295389	splice site	probably benign
IGL01605:Ptk2	APN	15	73264339	splice site	probably benign
IGL01631:Ptk2	APN	15	73216371	missense	probably damaging	1.00
IGL01952:Ptk2	APN	15	73229931	missense	probably damaging	0.99
IGL01957:Ptk2	APN	15	73242473	missense	probably benign	0.05
IGL02441:Ptk2	APN	15	73320826	missense	probably benign	0.16
IGL02471:Ptk2	APN	15	73298187	missense	probably benign	0.41
IGL02621:Ptk2	APN	15	73206145	missense	probably damaging	0.99
IGL03198:Ptk2	APN	15	73236216	missense	probably damaging	1.00
Shooter	UTSW	15	73304444	missense	possibly damaging	0.83
R0239:Ptk2	UTSW	15	73343283	unclassified	probably null
R0239:Ptk2	UTSW	15	73343283	unclassified	probably null
R1254:Ptk2	UTSW	15	73229970	missense	probably benign	0.01
R1291:Ptk2	UTSW	15	73210756	missense	probably damaging	1.00
R1307:Ptk2	UTSW	15	73292046	missense	probably benign	0.01
R1608:Ptk2	UTSW	15	73262575	missense	probably damaging	0.98
R1690:Ptk2	UTSW	15	73262610	missense	probably damaging	1.00
R1724:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1725:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1740:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1741:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1840:Ptk2	UTSW	15	73210884	missense	probably damaging	1.00
R1956:Ptk2	UTSW	15	73215983	missense	possibly damaging	0.49
R2022:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2092:Ptk2	UTSW	15	73236191	nonsense	probably null
R2114:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2115:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2336:Ptk2	UTSW	15	73266116	missense	probably damaging	1.00
R2571:Ptk2	UTSW	15	73231919	missense	probably damaging	1.00
R4232:Ptk2	UTSW	15	73309849	missense	possibly damaging	0.61
R4245:Ptk2	UTSW	15	73231976	missense	probably benign	0.00
R4594:Ptk2	UTSW	15	73206196	missense	probably damaging	1.00
R4688:Ptk2	UTSW	15	73206225	missense	probably damaging	1.00
R4834:Ptk2	UTSW	15	73216096	splice site	probably null
R4847:Ptk2	UTSW	15	73231956	missense	probably benign
R5558:Ptk2	UTSW	15	73304445	missense	probably damaging	0.97
R5682:Ptk2	UTSW	15	73262564	nonsense	probably null
R5858:Ptk2	UTSW	15	73321095	missense	probably benign	0.12
R5951:Ptk2	UTSW	15	73303833	missense	possibly damaging	0.88
R6014:Ptk2	UTSW	15	73304444	missense	possibly damaging	0.83
R6027:Ptk2	UTSW	15	73229913	missense	probably damaging	1.00
R6082:Ptk2	UTSW	15	73276865	missense	probably damaging	1.00
R7025:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7031:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7032:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7077:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7078:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7079:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7090:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7091:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7092:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7136:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7137:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7798:Ptk2	UTSW	15	73295375	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACACTTCATCTTTATCCCAGAG -3'
(R):5'- CCTGACTCTTAAGGCTCTTGAG -3'

Sequencing Primer
(F):5'- ACTTCATCTTTATCCCAGAGAAGTC -3'
(R):5'- GACTCTTAAGGCTCTTGAGAATAGGC -3'

Posted On

2020-01-23