Incidental Mutation 'R8057:Sec31b'
ID619495
Institutional Source Beutler Lab
Gene Symbol Sec31b
Ensembl Gene ENSMUSG00000051984
Gene NameSec31 homolog B (S. cerevisiae)
SynonymsLOC240667, Sec31l2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R8057 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location44516957-44545864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44519365 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 747 (P747T)
Ref Sequence ENSEMBL: ENSMUSP00000107616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]
Predicted Effect probably damaging
Transcript: ENSMUST00000063632
AA Change: P904T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: P904T

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111985
AA Change: P747T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984
AA Change: P747T

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165758
SMART Domains Protein: ENSMUSP00000130598
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik C T 16: 8,830,368 probably benign Het
4930523C07Rik T C 1: 160,075,256 L32P probably damaging Het
4930563M21Rik T C 9: 56,009,280 T38A unknown Het
Abcb6 T C 1: 75,174,358 N563D probably damaging Het
Ak4 T C 4: 101,460,653 F140S probably damaging Het
Arhgap27 T A 11: 103,338,693 R296S probably damaging Het
Atxn7l1 A C 12: 33,326,002 K98N probably damaging Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Camta1 T C 4: 151,144,032 D781G probably damaging Het
Capn7 A G 14: 31,370,979 D800G probably benign Het
Carmil2 G A 8: 105,692,376 V716I probably benign Het
Cdk5 C A 5: 24,420,784 D144Y probably damaging Het
Chd5 T A 4: 152,366,372 L651Q probably damaging Het
Clcn7 C T 17: 25,149,259 Q261* probably null Het
Cntnap2 T A 6: 46,347,145 F576Y probably damaging Het
Col11a1 G A 3: 114,131,614 G815D unknown Het
Col4a4 T A 1: 82,523,870 R387S unknown Het
Cse1l T A 2: 166,939,925 V663D probably damaging Het
Csf2rb2 G T 15: 78,285,006 Q650K probably damaging Het
Ctnnd2 A G 15: 30,847,351 D696G possibly damaging Het
D17Wsu92e C T 17: 27,767,889 A288T unknown Het
Dnah7c T A 1: 46,688,952 C2937S possibly damaging Het
Epha10 A T 4: 124,902,683 Q395L Het
Fam167a T A 14: 63,452,320 V22E probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabra4 A G 5: 71,623,952 I372T probably benign Het
Gm3550 T C 18: 34,737,529 F39L probably damaging Het
Gpt A G 15: 76,696,772 probably benign Het
H2-K1 C T 17: 33,996,859 G336D possibly damaging Het
Hoxd8 T C 2: 74,704,726 probably null Het
Kdm5d T G Y: 927,355 D658E possibly damaging Het
Krt25 G A 11: 99,317,343 T353M probably benign Het
Lonp2 T C 8: 86,714,089 L778P probably damaging Het
Lrrc66 G A 5: 73,607,532 Q723* probably null Het
Mak T A 13: 41,049,337 I212F probably damaging Het
Mastl T A 2: 23,133,554 R386W possibly damaging Het
Mis18bp1 A G 12: 65,148,899 I697T possibly damaging Het
Nek5 G A 8: 22,088,906 T415I probably benign Het
Neu3 T A 7: 99,814,228 N96I probably benign Het
Nxph2 T C 2: 23,400,095 V153A possibly damaging Het
Odf3l2 T A 10: 79,640,001 H243L probably damaging Het
Olfr1454 G A 19: 13,063,274 probably benign Het
Olfr518 A T 7: 108,881,364 F81I probably damaging Het
Olfr878 A G 9: 37,919,164 D169G probably benign Het
Otogl T C 10: 107,808,615 T1257A probably benign Het
Pcdh10 G A 3: 45,379,259 V3M probably benign Het
Pitpnm1 G A 19: 4,112,145 R1017Q probably null Het
Plcb3 A C 19: 6,955,095 H1065Q probably benign Het
Plcb3 A T 19: 6,958,899 M752K probably damaging Het
Plch1 T C 3: 63,698,136 E1449G probably benign Het
Plekha4 T A 7: 45,549,271 C573S probably benign Het
Plin2 T C 4: 86,657,401 I304V possibly damaging Het
Pnp2 G A 14: 50,964,381 V275I probably benign Het
Polr1a G A 6: 71,931,660 A490T possibly damaging Het
Ppp1r12b A G 1: 134,955,616 F56S probably damaging Het
Ptk2 GA G 15: 73,298,199 probably null Het
Rb1cc1 C A 1: 6,245,219 R473S probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx T C 9: 52,065,646 V65A probably damaging Het
Rps6ka5 A G 12: 100,573,796 probably null Het
Samd5 C T 10: 9,674,897 V23M probably damaging Het
Scn9a T G 2: 66,515,430 R1117S probably benign Het
Scrn1 T A 6: 54,520,773 I278L probably benign Het
Sipa1l2 A T 8: 125,468,530 V823E probably damaging Het
Slc2a13 T C 15: 91,516,416 N201S probably damaging Het
Snx31 C A 15: 36,523,460 V359F probably damaging Het
Sstr2 A G 11: 113,624,273 E6G probably benign Het
Stc2 C A 11: 31,367,806 E72* probably null Het
Tead1 C T 7: 112,759,514 P11L probably benign Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tmem63c A T 12: 87,072,198 K301* probably null Het
Tns3 G C 11: 8,492,773 A530G probably benign Het
Trat1 T C 16: 48,742,237 D70G probably damaging Het
Trex1 T A 9: 109,058,329 E198V probably damaging Het
Ttn T G 2: 76,739,728 R26940S probably damaging Het
Uba2 T C 7: 34,168,410 K34R possibly damaging Het
Vps13d A C 4: 144,975,183 M4376R Het
Zfp157 C A 5: 138,456,074 T178K probably damaging Het
Zfp318 T A 17: 46,399,766 V805D possibly damaging Het
Other mutations in Sec31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sec31b APN 19 44527041 missense probably damaging 1.00
IGL01308:Sec31b APN 19 44523683 missense probably benign 0.02
IGL02404:Sec31b APN 19 44534788 missense probably damaging 0.99
IGL02663:Sec31b APN 19 44534278 missense probably damaging 1.00
IGL02728:Sec31b APN 19 44523115 missense probably damaging 0.96
IGL02830:Sec31b APN 19 44531703 missense probably damaging 1.00
IGL03141:Sec31b APN 19 44526320 splice site probably benign
IGL03247:Sec31b APN 19 44518940 missense possibly damaging 0.62
R0049:Sec31b UTSW 19 44520408 splice site probably benign
R0137:Sec31b UTSW 19 44534382 missense probably damaging 1.00
R0238:Sec31b UTSW 19 44525469 unclassified probably benign
R0239:Sec31b UTSW 19 44525469 unclassified probably benign
R0468:Sec31b UTSW 19 44518508 splice site probably benign
R0504:Sec31b UTSW 19 44534786 missense probably damaging 1.00
R0565:Sec31b UTSW 19 44524553 missense probably damaging 1.00
R0627:Sec31b UTSW 19 44525607 missense probably benign
R0749:Sec31b UTSW 19 44524506 missense probably damaging 0.96
R0815:Sec31b UTSW 19 44518173 nonsense probably null
R1162:Sec31b UTSW 19 44517648 nonsense probably null
R1398:Sec31b UTSW 19 44523665 missense probably benign 0.04
R1436:Sec31b UTSW 19 44536195 missense probably damaging 0.99
R1538:Sec31b UTSW 19 44518586 missense probably benign 0.42
R1599:Sec31b UTSW 19 44523153 missense possibly damaging 0.92
R2044:Sec31b UTSW 19 44536156 missense probably benign 0.07
R2135:Sec31b UTSW 19 44534696 missense probably damaging 0.99
R2167:Sec31b UTSW 19 44543353 missense possibly damaging 0.89
R2211:Sec31b UTSW 19 44523150 missense probably damaging 1.00
R2938:Sec31b UTSW 19 44536179 missense probably damaging 0.99
R3113:Sec31b UTSW 19 44518185 nonsense probably null
R4110:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4111:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4113:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4158:Sec31b UTSW 19 44525186 missense probably benign 0.34
R4226:Sec31b UTSW 19 44531710 missense probably benign
R4646:Sec31b UTSW 19 44526621 missense probably benign 0.00
R4732:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4733:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4795:Sec31b UTSW 19 44531746 missense probably benign 0.00
R4877:Sec31b UTSW 19 44535733 missense probably damaging 1.00
R5150:Sec31b UTSW 19 44520531 missense probably benign 0.08
R5377:Sec31b UTSW 19 44518637 missense probably damaging 1.00
R5381:Sec31b UTSW 19 44534371 missense probably damaging 1.00
R5708:Sec31b UTSW 19 44523144 missense probably damaging 1.00
R6002:Sec31b UTSW 19 44535764 missense probably benign 0.04
R6185:Sec31b UTSW 19 44543284 missense possibly damaging 0.77
R6675:Sec31b UTSW 19 44523775 missense probably benign
R6946:Sec31b UTSW 19 44534316 missense probably damaging 1.00
R7139:Sec31b UTSW 19 44518936 missense probably benign 0.00
R7237:Sec31b UTSW 19 44517708 missense probably damaging 1.00
R7270:Sec31b UTSW 19 44523043 missense probably benign 0.00
R7340:Sec31b UTSW 19 44528722 missense probably benign 0.00
R7505:Sec31b UTSW 19 44543707 missense probably damaging 1.00
R7584:Sec31b UTSW 19 44543323 missense probably damaging 0.99
R7584:Sec31b UTSW 19 44531556 intron probably null
R7763:Sec31b UTSW 19 44523835 critical splice acceptor site probably null
R7777:Sec31b UTSW 19 44523773 nonsense probably null
R7900:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R7983:Sec31b UTSW 19 44526230 missense probably damaging 1.00
RF023:Sec31b UTSW 19 44535787 missense probably damaging 1.00
Z1177:Sec31b UTSW 19 44517314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTTAGTTCACTGGCTTG -3'
(R):5'- TCCTTTCCAAATGAAGGCTGG -3'

Sequencing Primer
(F):5'- CCTTAGTTCACTGGCTTGAGGAAC -3'
(R):5'- CTTTCCAAATGAAGGCTGGTGATAAG -3'
Posted On2020-01-23