Incidental Mutation 'R8058:Arfgap2'
ID619504
Institutional Source Beutler Lab
Gene Symbol Arfgap2
Ensembl Gene ENSMUSG00000027255
Gene NameADP-ribosylation factor GTPase activating protein 2
Synonyms2310032E02Rik, Zfp289
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.832) question?
Stock #R8058 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location91264974-91276931 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 91266299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028691] [ENSMUST00000028691] [ENSMUST00000028694] [ENSMUST00000059566] [ENSMUST00000080008] [ENSMUST00000111349] [ENSMUST00000131711] [ENSMUST00000134699] [ENSMUST00000138470] [ENSMUST00000156919] [ENSMUST00000168916]
Predicted Effect probably null
Transcript: ENSMUST00000028691
SMART Domains Protein: ENSMUSP00000028691
Gene: ENSMUSG00000027255

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 227 246 N/A INTRINSIC
coiled coil region 254 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Blast:ArfGap 370 434 6e-32 BLAST
low complexity region 468 476 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000028691
SMART Domains Protein: ENSMUSP00000028691
Gene: ENSMUSG00000027255

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 227 246 N/A INTRINSIC
coiled coil region 254 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Blast:ArfGap 370 434 6e-32 BLAST
low complexity region 468 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028694
SMART Domains Protein: ENSMUSP00000028694
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059566
SMART Domains Protein: ENSMUSP00000054391
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080008
SMART Domains Protein: ENSMUSP00000078920
Gene: ENSMUSG00000027255

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 213 232 N/A INTRINSIC
coiled coil region 240 307 N/A INTRINSIC
low complexity region 309 321 N/A INTRINSIC
internal_repeat_1 333 376 9.77e-5 PROSPERO
low complexity region 454 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111349
SMART Domains Protein: ENSMUSP00000106981
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128684
SMART Domains Protein: ENSMUSP00000118915
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
PDB:3SYV|H 2 61 3e-37 PDB
low complexity region 62 74 N/A INTRINSIC
SCOP:d1k4us_ 86 112 6e-7 SMART
PDB:2X3X|E 88 112 7e-7 PDB
Blast:SH3 91 112 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131711
SMART Domains Protein: ENSMUSP00000117214
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134699
SMART Domains Protein: ENSMUSP00000115046
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138470
SMART Domains Protein: ENSMUSP00000117230
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156919
SMART Domains Protein: ENSMUSP00000122779
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168916
SMART Domains Protein: ENSMUSP00000129175
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a zinc-finger-containing GTPase-activating protein for ADP ribosylation factor 1 (ARF1), a small GTPase that plays a role in coatomer-mediated vesicular trafficking. This gene product stimulates the hydrolysis of ARF1-bound GTP, which may lead to dissociation of coatomer from Golgi-derived membranes to allow fusion with target membranes. It may regulate the retrograde transport from the Golgi complex to the endoplasmic reticulum. Expression of this gene has been shown to be controlled by inhibitor of DNA binding 1 (Id1). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,081,954 D769N possibly damaging Het
Abcb6 A G 1: 75,180,009 L37P possibly damaging Het
Abcg1 G T 17: 31,105,530 A250S probably benign Het
Acsf3 C T 8: 122,813,634 H524Y possibly damaging Het
Agbl4 A G 4: 110,660,842 K110R unknown Het
B4galt4 T C 16: 38,766,021 probably null Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C8b A T 4: 104,790,614 D334V probably damaging Het
Capn11 T C 17: 45,643,755 Q152R probably null Het
Ccdc171 C A 4: 83,580,766 Q234K probably damaging Het
Clec2h A G 6: 128,674,003 D82G probably benign Het
Creld2 A G 15: 88,826,429 D349G probably damaging Het
D430041D05Rik A G 2: 104,148,783 *1415Q probably null Het
D430042O09Rik A G 7: 125,843,016 E725G probably benign Het
Dnmt3a T C 12: 3,902,768 V755A possibly damaging Het
Doc2a G T 7: 126,850,992 V201L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 G T 2: 125,351,969 D1359E possibly damaging Het
Fcnb T C 2: 28,079,695 Y120C probably damaging Het
Fras1 T A 5: 96,694,919 D1665E probably benign Het
Fry A T 5: 150,495,767 D524V Het
Garem1 A G 18: 21,148,564 L245P probably damaging Het
Gdf6 A G 4: 9,859,712 S265G probably benign Het
Gm5591 T C 7: 38,518,939 I837V probably benign Het
Gpr61 T C 3: 108,150,895 Y150C probably damaging Het
Grin2b A T 6: 135,733,227 L1107Q probably damaging Het
Helb A G 10: 120,105,578 S402P probably benign Het
Htt A G 5: 34,820,100 T777A probably benign Het
Iffo2 A G 4: 139,613,853 D383G probably benign Het
Ikzf3 G T 11: 98,516,927 Y29* probably null Het
Ints2 A T 11: 86,255,353 M143K probably benign Het
Jmjd1c T C 10: 67,254,495 V2292A not run Het
Lamb1 C A 12: 31,303,047 Q916K probably benign Het
Lrrtm4 G A 6: 80,022,545 M313I probably benign Het
Lum A G 10: 97,568,563 I107V probably benign Het
Ly6h T C 15: 75,565,212 E126G probably benign Het
Map3k5 G A 10: 20,132,114 V1230M probably damaging Het
Mcoln1 T C 8: 3,508,378 F211L probably benign Het
Mink1 G A 11: 70,603,768 W258* probably null Het
Muc16 G T 9: 18,660,002 S407* probably null Het
Ngef G A 1: 87,546,022 Q13* probably null Het
Nxpe5 T A 5: 138,239,311 Y44* probably null Het
Olfr1094 A G 2: 86,829,708 R319G probably benign Het
Olfr1098 C A 2: 86,922,807 A242S probably benign Het
Olfr1250 A G 2: 89,657,327 V38A probably benign Het
Olfr18 T A 9: 20,314,180 I247F probably damaging Het
Olfr270 T A 4: 52,971,106 L162M probably benign Het
Olfr938 A T 9: 39,078,566 Y60N probably damaging Het
Orc3 C A 4: 34,595,223 E249* probably null Het
Otogl A T 10: 107,762,426 C2288S probably damaging Het
Pde1b A G 15: 103,524,811 E249G probably damaging Het
Phf2 T C 13: 48,823,082 E219G unknown Het
Rbm19 T A 5: 120,140,375 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Sbk2 A G 7: 4,957,290 Y294H possibly damaging Het
Selenoo T C 15: 89,092,739 I198T possibly damaging Het
Sema3f T C 9: 107,682,601 E729G probably benign Het
Serpinb1b A T 13: 33,085,310 T9S probably benign Het
Sfxn4 T C 19: 60,844,252 T235A probably damaging Het
Shc4 A T 2: 125,649,234 Y461* probably null Het
Slc22a15 T C 3: 101,864,610 D391G probably benign Het
Slc22a23 G T 13: 34,305,184 Y239* probably null Het
Slc24a2 G A 4: 86,991,513 A656V probably damaging Het
Slc2a5 A T 4: 150,143,133 I470F probably damaging Het
Sptbn4 T C 7: 27,364,269 E2249G possibly damaging Het
Tas2r139 A T 6: 42,141,819 Q295L probably benign Het
Tdrd7 C A 4: 46,034,309 S1051R probably benign Het
Tmem2 C A 19: 21,852,331 A1268E probably benign Het
Tnfrsf18 G A 4: 156,028,345 A163T probably benign Het
Ube3b T C 5: 114,406,785 V596A possibly damaging Het
Vmn2r10 T A 5: 109,002,089 N363I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Yod1 C T 1: 130,719,069 Q228* probably null Het
Zfp433 A T 10: 81,720,290 K209* probably null Het
Zfp865 G A 7: 5,030,446 V477I probably benign Het
Zfp937 T A 2: 150,239,501 Y484N probably benign Het
Zfp951 T G 5: 104,814,446 H418P probably damaging Het
Other mutations in Arfgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0178:Arfgap2 UTSW 2 91267361 missense probably benign 0.00
R0927:Arfgap2 UTSW 2 91273805 missense probably benign 0.05
R1491:Arfgap2 UTSW 2 91274859 missense probably damaging 1.00
R1693:Arfgap2 UTSW 2 91270075 splice site probably null
R2091:Arfgap2 UTSW 2 91270241 missense probably benign 0.02
R2199:Arfgap2 UTSW 2 91265692 critical splice donor site probably null
R3772:Arfgap2 UTSW 2 91265366 missense probably benign
R3922:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R3926:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R4707:Arfgap2 UTSW 2 91269971 missense probably damaging 1.00
R4751:Arfgap2 UTSW 2 91267368 missense probably benign 0.10
R4923:Arfgap2 UTSW 2 91273659 missense probably damaging 1.00
R5249:Arfgap2 UTSW 2 91265637 nonsense probably null
R5541:Arfgap2 UTSW 2 91275769 missense probably benign 0.09
R5608:Arfgap2 UTSW 2 91270202 missense probably damaging 1.00
R5626:Arfgap2 UTSW 2 91275392 nonsense probably null
R6261:Arfgap2 UTSW 2 91270282 missense probably benign 0.00
R6300:Arfgap2 UTSW 2 91267195 missense probably benign 0.00
R6948:Arfgap2 UTSW 2 91267179 missense probably benign 0.00
R7531:Arfgap2 UTSW 2 91273744 splice site probably null
R8121:Arfgap2 UTSW 2 91265683 missense probably benign 0.01
R8179:Arfgap2 UTSW 2 91275323 missense probably damaging 1.00
R8825:Arfgap2 UTSW 2 91273561 missense probably damaging 1.00
Z1177:Arfgap2 UTSW 2 91275104 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGTGACTGATGGTTCCTGGAC -3'
(R):5'- AGCACCTGTCTAGTTCAGTTTG -3'

Sequencing Primer
(F):5'- TGATGGTTCCTGGACACCCAC -3'
(R):5'- TTTCAAATGCTATCCCAAAAGTCC -3'
Posted On2020-01-23