Mutagenetix > Incidental Mutations

Incidental Mutation 'R8058:Fbn1'

619506

Institutional Source

Beutler Lab

Gene Symbol

Fbn1

Ensembl Gene

ENSMUSG00000027204

Gene Name

fibrillin 1

Synonyms

Fib-1

MMRRC Submission

Accession Numbers

Genbank: NM_007993; MGI: 95489

Is this an essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R8058 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

125300594-125507993 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 125351969 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1359 (D1359E)

Ref Sequence

ENSEMBL: ENSMUSP00000028633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028633] [ENSMUST00000103234]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028633
AA Change: D1359E

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000028633
Gene: ENSMUSG00000027204
AA Change: D1359E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	38	49	N/A	INTRINSIC
EGF	118	146	8.52e0	SMART
EGF	149	178	5.4e-2	SMART
Pfam:TB	193	235	6.9e-17	PFAM
EGF_CA	246	287	3.56e-11	SMART
EGF_CA	288	329	9.39e-11	SMART
Pfam:TB	343	388	2.3e-17	PFAM
low complexity region	394	445	N/A	INTRINSIC
EGF	454	491	8.57e-5	SMART
EGF_CA	492	531	9.39e-11	SMART
EGF_CA	532	573	2.38e-12	SMART
EGF_CA	574	614	5.48e-12	SMART
EGF_CA	615	655	5.39e-11	SMART
Pfam:TB	670	712	1.4e-17	PFAM
EGF_CA	725	766	1.53e-10	SMART
EGF_CA	767	808	2.42e-13	SMART
EGF_CA	809	848	2.44e-9	SMART
Pfam:TB	862	902	2.1e-14	PFAM
EGF_CA	912	953	3.32e-11	SMART
Pfam:TB	967	1009	3.9e-17	PFAM
EGF_CA	1030	1071	5.11e-12	SMART
EGF_CA	1072	1114	5.39e-11	SMART
EGF_CA	1115	1156	1.55e-11	SMART
EGF_CA	1157	1198	5.48e-12	SMART
EGF_CA	1199	1239	5.61e-9	SMART
EGF_CA	1240	1281	1.22e-9	SMART
EGF_CA	1282	1323	2.62e-9	SMART
EGF_CA	1324	1364	3.27e-10	SMART
EGF_CA	1365	1405	4.7e-11	SMART
EGF_CA	1406	1447	1.91e-11	SMART
EGF_CA	1448	1488	1.98e-9	SMART
EGF_CA	1489	1529	2.13e-9	SMART
Pfam:TB	1549	1590	3.5e-18	PFAM
EGF_CA	1608	1649	2.19e-11	SMART
EGF_CA	1650	1690	3.97e-9	SMART
Pfam:TB	1706	1749	9.7e-18	PFAM
EGF_CA	1768	1809	5.11e-12	SMART
EGF_CA	1810	1850	1.1e-11	SMART
EGF_CA	1851	1892	5.69e-10	SMART
EGF_CA	1893	1931	6.1e-10	SMART
EGF_CA	1932	1974	2.11e-13	SMART
EGF_CA	1975	2014	7.23e-12	SMART
EGF_CA	2015	2056	3.15e-12	SMART
Pfam:TB	2070	2112	3.7e-17	PFAM
EGF_CA	2129	2167	1.24e-10	SMART
EGF_CA	2168	2207	3.81e-11	SMART
EGF_CA	2208	2248	3.81e-11	SMART
EGF	2252	2292	5.24e0	SMART
EGF_CA	2293	2334	9.91e-10	SMART
Pfam:TB	2348	2391	8.5e-18	PFAM
EGF_CA	2404	2445	1.26e-11	SMART
EGF_CA	2446	2486	1.06e-9	SMART
EGF_CA	2487	2525	3.1e-11	SMART
EGF_CA	2526	2568	1.48e-8	SMART
EGF_CA	2569	2608	1.14e-9	SMART
EGF_CA	2609	2649	3.97e-9	SMART
EGF_CA	2650	2689	1.98e-9	SMART
low complexity region	2691	2698	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103234
AA Change: D1359E

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099524
Gene: ENSMUSG00000027204
AA Change: D1359E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	38	49	N/A	INTRINSIC
EGF	118	146	8.52e0	SMART
EGF	149	178	5.4e-2	SMART
Pfam:TB	194	232	3.5e-10	PFAM
EGF_CA	246	287	3.56e-11	SMART
EGF_CA	288	329	9.39e-11	SMART
Pfam:TB	344	388	6.8e-15	PFAM
low complexity region	394	445	N/A	INTRINSIC
EGF	454	491	8.57e-5	SMART
EGF_CA	492	531	9.39e-11	SMART
EGF_CA	532	573	2.38e-12	SMART
EGF_CA	574	614	5.48e-12	SMART
EGF_CA	615	655	5.39e-11	SMART
Pfam:TB	671	712	8.3e-16	PFAM
EGF_CA	725	766	1.53e-10	SMART
EGF_CA	767	808	2.42e-13	SMART
EGF_CA	809	848	2.44e-9	SMART
Pfam:TB	863	898	3.1e-8	PFAM
EGF_CA	912	953	3.32e-11	SMART
Pfam:TB	968	1009	1.5e-15	PFAM
EGF_CA	1030	1071	5.11e-12	SMART
EGF_CA	1072	1114	5.39e-11	SMART
EGF_CA	1115	1156	1.55e-11	SMART
EGF_CA	1157	1198	5.48e-12	SMART
EGF_CA	1199	1239	5.61e-9	SMART
EGF_CA	1240	1281	1.22e-9	SMART
EGF_CA	1282	1323	2.62e-9	SMART
EGF_CA	1324	1364	3.27e-10	SMART
EGF_CA	1365	1405	4.7e-11	SMART
EGF_CA	1406	1447	1.91e-11	SMART
EGF_CA	1448	1488	1.98e-9	SMART
EGF_CA	1489	1529	2.13e-9	SMART
Pfam:TB	1550	1590	5.3e-17	PFAM
EGF_CA	1608	1649	2.19e-11	SMART
EGF_CA	1650	1690	3.97e-9	SMART
Pfam:TB	1707	1749	1.6e-16	PFAM
EGF_CA	1768	1809	5.11e-12	SMART
EGF_CA	1810	1850	1.1e-11	SMART
EGF_CA	1851	1892	5.69e-10	SMART
EGF_CA	1893	1931	6.1e-10	SMART
EGF_CA	1932	1974	2.11e-13	SMART
EGF_CA	1975	2014	7.23e-12	SMART
EGF_CA	2015	2056	3.15e-12	SMART
Pfam:TB	2071	2112	1.9e-15	PFAM
EGF_CA	2129	2167	1.24e-10	SMART
EGF_CA	2168	2207	3.81e-11	SMART
EGF_CA	2208	2248	3.81e-11	SMART
EGF	2252	2292	5.24e0	SMART
EGF_CA	2293	2334	9.91e-10	SMART
Pfam:TB	2349	2391	5.8e-15	PFAM
EGF_CA	2404	2445	1.26e-11	SMART
EGF_CA	2446	2486	1.06e-9	SMART
EGF_CA	2487	2525	3.1e-11	SMART
EGF_CA	2526	2568	1.48e-8	SMART
EGF_CA	2569	2608	1.14e-9	SMART
EGF_CA	2609	2649	3.97e-9	SMART
EGF_CA	2650	2689	1.98e-9	SMART
low complexity region	2691	2698	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

Strain: 1934905; 4880665
Lethality: D7-D10
FUNCTION: This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Homozygous knockout mice for this gene exhibit impaired aortic development and early postnatal death, which was attributed to a deficiency in the fibrillin-1 protein. Mice with a hypomorphic allele of this gene exhibit impaired glucose homeostasis, likely due to a reduction in serum asprosin levels. [provided by RefSeq, Apr 2016]
PHENOTYPE: Lethality among homozygotes for spontaneous and targeted mutations ranges from embryonic death to death around 4 months. Abnormalities include vascular defects, excess bone growth, connective tissue hyperplasia, and lung emphysema. Mice heterozygous for a knock-in allele exhibit scleroderma. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(9) Spontaneous(1)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	C	T	4: 53,081,954	D769N	possibly damaging	Het
Abcb6	A	G	1: 75,180,009	L37P	possibly damaging	Het
Abcg1	G	T	17: 31,105,530	A250S	probably benign	Het
Acsf3	C	T	8: 122,813,634	H524Y	possibly damaging	Het
Agbl4	A	G	4: 110,660,842	K110R	unknown	Het
Arfgap2	G	A	2: 91,266,299		probably null	Het
B4galt4	T	C	16: 38,766,021		probably null	Het
Bex6	G	T	16: 32,186,406	D11Y	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
C8b	A	T	4: 104,790,614	D334V	probably damaging	Het
Capn11	T	C	17: 45,643,755	Q152R	probably null	Het
Ccdc171	C	A	4: 83,580,766	Q234K	probably damaging	Het
Clec2h	A	G	6: 128,674,003	D82G	probably benign	Het
Creld2	A	G	15: 88,826,429	D349G	probably damaging	Het
D430041D05Rik	A	G	2: 104,148,783	*1415Q	probably null	Het
D430042O09Rik	A	G	7: 125,843,016	E725G	probably benign	Het
Dnmt3a	T	C	12: 3,902,768	V755A	possibly damaging	Het
Doc2a	G	T	7: 126,850,992	V201L	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fcnb	T	C	2: 28,079,695	Y120C	probably damaging	Het
Fras1	T	A	5: 96,694,919	D1665E	probably benign	Het
Fry	A	T	5: 150,495,767	D524V		Het
Garem1	A	G	18: 21,148,564	L245P	probably damaging	Het
Gdf6	A	G	4: 9,859,712	S265G	probably benign	Het
Gm5591	T	C	7: 38,518,939	I837V	probably benign	Het
Gpr61	T	C	3: 108,150,895	Y150C	probably damaging	Het
Grin2b	A	T	6: 135,733,227	L1107Q	probably damaging	Het
Helb	A	G	10: 120,105,578	S402P	probably benign	Het
Htt	A	G	5: 34,820,100	T777A	probably benign	Het
Iffo2	A	G	4: 139,613,853	D383G	probably benign	Het
Ikzf3	G	T	11: 98,516,927	Y29*	probably null	Het
Ints2	A	T	11: 86,255,353	M143K	probably benign	Het
Jmjd1c	T	C	10: 67,254,495	V2292A	not run	Het
Lamb1	C	A	12: 31,303,047	Q916K	probably benign	Het
Lrrtm4	G	A	6: 80,022,545	M313I	probably benign	Het
Lum	A	G	10: 97,568,563	I107V	probably benign	Het
Ly6h	T	C	15: 75,565,212	E126G	probably benign	Het
Map3k5	G	A	10: 20,132,114	V1230M	probably damaging	Het
Mcoln1	T	C	8: 3,508,378	F211L	probably benign	Het
Mink1	G	A	11: 70,603,768	W258*	probably null	Het
Muc16	G	T	9: 18,660,002	S407*	probably null	Het
Ngef	G	A	1: 87,546,022	Q13*	probably null	Het
Nxpe5	T	A	5: 138,239,311	Y44*	probably null	Het
Olfr1094	A	G	2: 86,829,708	R319G	probably benign	Het
Olfr1098	C	A	2: 86,922,807	A242S	probably benign	Het
Olfr1250	A	G	2: 89,657,327	V38A	probably benign	Het
Olfr18	T	A	9: 20,314,180	I247F	probably damaging	Het
Olfr270	T	A	4: 52,971,106	L162M	probably benign	Het
Olfr938	A	T	9: 39,078,566	Y60N	probably damaging	Het
Orc3	C	A	4: 34,595,223	E249*	probably null	Het
Otogl	A	T	10: 107,762,426	C2288S	probably damaging	Het
Pde1b	A	G	15: 103,524,811	E249G	probably damaging	Het
Phf2	T	C	13: 48,823,082	E219G	unknown	Het
Rbm19	T	A	5: 120,140,375		probably null	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Het
Sbk2	A	G	7: 4,957,290	Y294H	possibly damaging	Het
Selenoo	T	C	15: 89,092,739	I198T	possibly damaging	Het
Sema3f	T	C	9: 107,682,601	E729G	probably benign	Het
Serpinb1b	A	T	13: 33,085,310	T9S	probably benign	Het
Sfxn4	T	C	19: 60,844,252	T235A	probably damaging	Het
Shc4	A	T	2: 125,649,234	Y461*	probably null	Het
Slc22a15	T	C	3: 101,864,610	D391G	probably benign	Het
Slc22a23	G	T	13: 34,305,184	Y239*	probably null	Het
Slc24a2	G	A	4: 86,991,513	A656V	probably damaging	Het
Slc2a5	A	T	4: 150,143,133	I470F	probably damaging	Het
Sptbn4	T	C	7: 27,364,269	E2249G	possibly damaging	Het
Tas2r139	A	T	6: 42,141,819	Q295L	probably benign	Het
Tdrd7	C	A	4: 46,034,309	S1051R	probably benign	Het
Tmem2	C	A	19: 21,852,331	A1268E	probably benign	Het
Tnfrsf18	G	A	4: 156,028,345	A163T	probably benign	Het
Ube3b	T	C	5: 114,406,785	V596A	possibly damaging	Het
Vmn2r10	T	A	5: 109,002,089	N363I	probably benign	Het
Vmn2r15	T	A	5: 109,293,090	I301F	probably damaging	Het
Yod1	C	T	1: 130,719,069	Q228*	probably null	Het
Zfp433	A	T	10: 81,720,290	K209*	probably null	Het
Zfp865	G	A	7: 5,030,446	V477I	probably benign	Het
Zfp937	T	A	2: 150,239,501	Y484N	probably benign	Het
Zfp951	T	G	5: 104,814,446	H418P	probably damaging	Het

Other mutations in Fbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Fbn1	APN	2	125324947	missense	probably damaging	1.00
IGL00159:Fbn1	APN	2	125397873	missense	probably benign	0.14
IGL00500:Fbn1	APN	2	125317516	missense	probably damaging	0.99
IGL00558:Fbn1	APN	2	125329128	splice site	probably benign
IGL00645:Fbn1	APN	2	125317103	splice site	probably benign
IGL00863:Fbn1	APN	2	125403219	missense	possibly damaging	0.84
IGL00926:Fbn1	APN	2	125319042	missense	possibly damaging	0.84
IGL00935:Fbn1	APN	2	125377910	nonsense	probably null
IGL00950:Fbn1	APN	2	125358823	missense	probably damaging	1.00
IGL01090:Fbn1	APN	2	125394776	splice site	probably benign
IGL01106:Fbn1	APN	2	125351706	missense	possibly damaging	0.55
IGL01486:Fbn1	APN	2	125389978	missense	probably benign	0.03
IGL01519:Fbn1	APN	2	125317019	missense	probably benign	0.07
IGL01585:Fbn1	APN	2	125360110	missense	probably damaging	0.98
IGL01730:Fbn1	APN	2	125312974	splice site	probably benign
IGL01793:Fbn1	APN	2	125387293	missense	possibly damaging	0.67
IGL01803:Fbn1	APN	2	125350287	missense	probably damaging	1.00
IGL01803:Fbn1	APN	2	125301725	missense	probably benign
IGL01916:Fbn1	APN	2	125315446	missense	possibly damaging	0.55
IGL02035:Fbn1	APN	2	125335362	splice site	probably null
IGL02097:Fbn1	APN	2	125363969	missense	probably damaging	1.00
IGL02233:Fbn1	APN	2	125321610	splice site	probably benign
IGL02512:Fbn1	APN	2	125338460	missense	probably damaging	1.00
IGL02552:Fbn1	APN	2	125412713	missense	possibly damaging	0.86
IGL02657:Fbn1	APN	2	125352025	missense	possibly damaging	0.86
IGL02718:Fbn1	APN	2	125369886	missense	probably damaging	1.00
IGL02863:Fbn1	APN	2	125303256	missense	possibly damaging	0.80
IGL02974:Fbn1	APN	2	125346330	missense	probably null	0.99
IGL03058:Fbn1	APN	2	125403200	missense	probably benign	0.03
IGL03172:Fbn1	APN	2	125320968	missense	possibly damaging	0.92
IGL03288:Fbn1	APN	2	125303183	missense	probably benign	0.13
Carinatum	UTSW	2	125342830	missense	possibly damaging	0.70
Elasticity	UTSW	2	125403132	missense	possibly damaging	0.63
Extensor	UTSW	2	125328158	missense	probably damaging	1.00
lincoln	UTSW	2	125403170	missense	possibly damaging	0.50
Long	UTSW	2	125317038	missense	probably damaging	1.00
Reach	UTSW	2	125382034	nonsense	probably null
reaper	UTSW	2	125315404	missense	probably damaging	0.98
Scythe	UTSW	2	125403228	missense	possibly damaging	0.84
string_bean	UTSW	2	125379134	splice site	probably null
wirey	UTSW	2	125309495	missense	probably benign
3-1:Fbn1	UTSW	2	125394605	splice site	probably benign
BB004:Fbn1	UTSW	2	125383736	missense	possibly damaging	0.82
BB014:Fbn1	UTSW	2	125383736	missense	possibly damaging	0.82
P0012:Fbn1	UTSW	2	125369321	splice site	probably benign
PIT4403001:Fbn1	UTSW	2	125342911	missense	probably damaging	1.00
PIT4466001:Fbn1	UTSW	2	125306501	missense	possibly damaging	0.90
PIT4472001:Fbn1	UTSW	2	125306501	missense	possibly damaging	0.90
PIT4651001:Fbn1	UTSW	2	125363989	critical splice acceptor site	probably null
R0226:Fbn1	UTSW	2	125320910	missense	possibly damaging	0.86
R0310:Fbn1	UTSW	2	125363644	missense	probably damaging	1.00
R0362:Fbn1	UTSW	2	125309777	missense	probably damaging	0.99
R0374:Fbn1	UTSW	2	125321676	missense	possibly damaging	0.86
R0433:Fbn1	UTSW	2	125348215	missense	possibly damaging	0.95
R0441:Fbn1	UTSW	2	125309755	critical splice donor site	probably null
R0501:Fbn1	UTSW	2	125301749	missense	probably benign	0.23
R0510:Fbn1	UTSW	2	125342925	splice site	probably benign
R0573:Fbn1	UTSW	2	125389249	missense	probably damaging	0.99
R0622:Fbn1	UTSW	2	125379024	missense	possibly damaging	0.88
R0630:Fbn1	UTSW	2	125394770	missense	possibly damaging	0.48
R0724:Fbn1	UTSW	2	125352064	missense	probably benign	0.14
R0739:Fbn1	UTSW	2	125367630	missense	probably benign	0.18
R0744:Fbn1	UTSW	2	125314814	splice site	probably benign
R0811:Fbn1	UTSW	2	125403170	missense	possibly damaging	0.50
R0812:Fbn1	UTSW	2	125403170	missense	possibly damaging	0.50
R0862:Fbn1	UTSW	2	125342891	nonsense	probably null
R0864:Fbn1	UTSW	2	125342891	nonsense	probably null
R1061:Fbn1	UTSW	2	125345963	missense	probably benign	0.01
R1126:Fbn1	UTSW	2	125321192	splice site	probably null
R1172:Fbn1	UTSW	2	125394687	missense	probably benign	0.13
R1175:Fbn1	UTSW	2	125394687	missense	probably benign	0.13
R1183:Fbn1	UTSW	2	125321617	missense	probably benign	0.07
R1218:Fbn1	UTSW	2	125412749	missense	possibly damaging	0.71
R1241:Fbn1	UTSW	2	125372527	splice site	probably benign
R1248:Fbn1	UTSW	2	125301609	missense	probably benign	0.01
R1345:Fbn1	UTSW	2	125314671	missense	probably damaging	1.00
R1374:Fbn1	UTSW	2	125346434	missense	probably damaging	0.99
R1458:Fbn1	UTSW	2	125301929	missense	probably benign	0.01
R1474:Fbn1	UTSW	2	125361265	missense	possibly damaging	0.72
R1496:Fbn1	UTSW	2	125309495	missense	probably benign
R1502:Fbn1	UTSW	2	125363706	nonsense	probably null
R1511:Fbn1	UTSW	2	125306285	missense	probably benign	0.00
R1588:Fbn1	UTSW	2	125319114	missense	probably benign	0.19
R1626:Fbn1	UTSW	2	125341279	missense	probably damaging	1.00
R1676:Fbn1	UTSW	2	125309781	missense	probably damaging	1.00
R1712:Fbn1	UTSW	2	125346434	missense	probably damaging	0.99
R1772:Fbn1	UTSW	2	125403228	missense	possibly damaging	0.84
R1776:Fbn1	UTSW	2	125321734	missense	possibly damaging	0.71
R1869:Fbn1	UTSW	2	125352027	missense	probably benign	0.00
R1894:Fbn1	UTSW	2	125394621	missense	probably damaging	0.96
R1925:Fbn1	UTSW	2	125363629	missense	probably damaging	1.00
R1957:Fbn1	UTSW	2	125367654	missense	possibly damaging	0.93
R1995:Fbn1	UTSW	2	125350373	critical splice acceptor site	probably null
R2140:Fbn1	UTSW	2	125343810	missense	probably damaging	1.00
R2142:Fbn1	UTSW	2	125412708	missense	possibly damaging	0.93
R2268:Fbn1	UTSW	2	125321741	missense	possibly damaging	0.49
R3409:Fbn1	UTSW	2	125412665	missense	possibly damaging	0.92
R3418:Fbn1	UTSW	2	125320926	missense	possibly damaging	0.55
R3508:Fbn1	UTSW	2	125306327	missense	probably benign	0.19
R3778:Fbn1	UTSW	2	125317086	missense	probably damaging	1.00
R3800:Fbn1	UTSW	2	125345974	missense	possibly damaging	0.63
R4001:Fbn1	UTSW	2	125477495	critical splice donor site	probably null
R4169:Fbn1	UTSW	2	125363952	missense	possibly damaging	0.86
R4398:Fbn1	UTSW	2	125397781	missense	probably benign	0.32
R4482:Fbn1	UTSW	2	125363610	critical splice donor site	probably null
R4559:Fbn1	UTSW	2	125351714	missense	possibly damaging	0.65
R4608:Fbn1	UTSW	2	125306500	missense	probably benign	0.05
R4634:Fbn1	UTSW	2	125344061	missense	probably damaging	1.00
R4706:Fbn1	UTSW	2	125370149	missense	probably benign	0.21
R4712:Fbn1	UTSW	2	125341316	missense	probably benign	0.12
R4783:Fbn1	UTSW	2	125324919	missense	probably damaging	1.00
R4784:Fbn1	UTSW	2	125324919	missense	probably damaging	1.00
R4785:Fbn1	UTSW	2	125324919	missense	probably damaging	1.00
R4793:Fbn1	UTSW	2	125321235	nonsense	probably null
R4838:Fbn1	UTSW	2	125372399	missense	probably benign	0.01
R4864:Fbn1	UTSW	2	125372397	missense	possibly damaging	0.92
R4887:Fbn1	UTSW	2	125309774	missense	probably damaging	1.00
R4942:Fbn1	UTSW	2	125383616	missense	possibly damaging	0.88
R4952:Fbn1	UTSW	2	125317534	missense	probably damaging	1.00
R5030:Fbn1	UTSW	2	125412704	missense	possibly damaging	0.51
R5044:Fbn1	UTSW	2	125329102	missense	probably damaging	0.97
R5057:Fbn1	UTSW	2	125466695	missense	probably benign	0.33
R5115:Fbn1	UTSW	2	125332383	missense	probably damaging	1.00
R5399:Fbn1	UTSW	2	125332333	missense	possibly damaging	0.69
R5498:Fbn1	UTSW	2	125360176	missense	probably damaging	1.00
R5526:Fbn1	UTSW	2	125365639	missense	possibly damaging	0.83
R5529:Fbn1	UTSW	2	125373950	missense	probably benign	0.01
R5602:Fbn1	UTSW	2	125321741	missense	possibly damaging	0.49
R5760:Fbn1	UTSW	2	125361247	missense	probably damaging	1.00
R5837:Fbn1	UTSW	2	125379134	splice site	probably null
R5955:Fbn1	UTSW	2	125358882	missense	probably damaging	1.00
R5980:Fbn1	UTSW	2	125315404	missense	probably damaging	0.98
R6039:Fbn1	UTSW	2	125363880	missense	probably damaging	1.00
R6039:Fbn1	UTSW	2	125363880	missense	probably damaging	1.00
R6058:Fbn1	UTSW	2	125466612	missense	possibly damaging	0.73
R6089:Fbn1	UTSW	2	125321225	missense	possibly damaging	0.55
R6136:Fbn1	UTSW	2	125403132	missense	possibly damaging	0.63
R6161:Fbn1	UTSW	2	125369801	nonsense	probably null
R6162:Fbn1	UTSW	2	125360227	missense	probably damaging	1.00
R6165:Fbn1	UTSW	2	125332363	missense	probably damaging	0.99
R6169:Fbn1	UTSW	2	125335489	critical splice acceptor site	probably null
R6221:Fbn1	UTSW	2	125320921	missense	probably benign	0.07
R6223:Fbn1	UTSW	2	125412671	missense	possibly damaging	0.86
R6225:Fbn1	UTSW	2	125330543	missense	probably damaging	1.00
R6238:Fbn1	UTSW	2	125324945	missense	probably damaging	0.98
R6329:Fbn1	UTSW	2	125308473	missense	possibly damaging	0.70
R6401:Fbn1	UTSW	2	125346450	missense	probably damaging	0.98
R6480:Fbn1	UTSW	2	125335418	missense	probably benign	0.05
R6513:Fbn1	UTSW	2	125383671	missense	probably damaging	1.00
R6530:Fbn1	UTSW	2	125389270	missense	probably damaging	0.99
R6595:Fbn1	UTSW	2	125342830	missense	possibly damaging	0.70
R6781:Fbn1	UTSW	2	125317038	missense	probably damaging	1.00
R6849:Fbn1	UTSW	2	125321691	missense	possibly damaging	0.82
R6860:Fbn1	UTSW	2	125328158	missense	probably damaging	1.00
R6960:Fbn1	UTSW	2	125382060	missense	probably benign	0.16
R7134:Fbn1	UTSW	2	125382049	missense	probably benign	0.03
R7241:Fbn1	UTSW	2	125306495	missense	possibly damaging	0.86
R7295:Fbn1	UTSW	2	125335487	missense	probably damaging	1.00
R7312:Fbn1	UTSW	2	125466674	missense	possibly damaging	0.53
R7322:Fbn1	UTSW	2	125479195	missense	possibly damaging	0.92
R7349:Fbn1	UTSW	2	125315401	missense	possibly damaging	0.84
R7365:Fbn1	UTSW	2	125352049	missense	probably damaging	0.97
R7392:Fbn1	UTSW	2	125343924	missense	probably damaging	1.00
R7442:Fbn1	UTSW	2	125403212	missense	possibly damaging	0.45
R7452:Fbn1	UTSW	2	125505455	missense	possibly damaging	0.53
R7453:Fbn1	UTSW	2	125320959	missense	possibly damaging	0.93
R7457:Fbn1	UTSW	2	125351747	missense	possibly damaging	0.90
R7458:Fbn1	UTSW	2	125319116	missense	probably benign	0.14
R7549:Fbn1	UTSW	2	125344027	missense	probably damaging	0.99
R7570:Fbn1	UTSW	2	125397852	missense	probably benign	0.29
R7666:Fbn1	UTSW	2	125306471	missense	probably damaging	1.00
R7723:Fbn1	UTSW	2	125382034	nonsense	probably null
R7745:Fbn1	UTSW	2	125303195	missense	probably benign	0.06
R7754:Fbn1	UTSW	2	125479280	splice site	probably null
R7780:Fbn1	UTSW	2	125301758	missense	probably benign	0.15
R7849:Fbn1	UTSW	2	125309485	missense	probably damaging	0.98
R7927:Fbn1	UTSW	2	125383736	missense	possibly damaging	0.82
R7942:Fbn1	UTSW	2	125412786	missense	possibly damaging	0.53
R7948:Fbn1	UTSW	2	125341299	missense	probably damaging	1.00
R7985:Fbn1	UTSW	2	125301878	missense	probably benign	0.01
R8051:Fbn1	UTSW	2	125306463	missense	possibly damaging	0.86
R8054:Fbn1	UTSW	2	125346018	missense	possibly damaging	0.93
R8113:Fbn1	UTSW	2	125477569	missense	probably damaging	1.00
R8307:Fbn1	UTSW	2	125505482	missense	possibly damaging	0.53
R8472:Fbn1	UTSW	2	125309802	missense	probably damaging	1.00
R8690:Fbn1	UTSW	2	125344095	critical splice acceptor site	probably benign
R8724:Fbn1	UTSW	2	125360146	missense	probably damaging	0.98
R8856:Fbn1	UTSW	2	125314717	missense	probably damaging	1.00
R8916:Fbn1	UTSW	2	125403229	missense	possibly damaging	0.63
R8931:Fbn1	UTSW	2	125360175	missense	probably damaging	1.00
X0019:Fbn1	UTSW	2	125383643	missense	possibly damaging	0.82
X0020:Fbn1	UTSW	2	125369340	missense	probably damaging	1.00
X0028:Fbn1	UTSW	2	125342798	critical splice donor site	probably null
X0067:Fbn1	UTSW	2	125369914	missense	possibly damaging	0.95
Z1088:Fbn1	UTSW	2	125350288	missense	probably damaging	0.99
Z1176:Fbn1	UTSW	2	125387350	missense	possibly damaging	0.51
Z1177:Fbn1	UTSW	2	125389231	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGTTCCATTAGAGCATTCATCC -3'
(R):5'- TGTTACGCCATAGTGAGGATGAG -3'

Sequencing Primer
(F):5'- GTTCCATTAGAGCATTCATCCAGATC -3'
(R):5'- TTCTAGGTCATTAAAAAGTCCCCC -3'

Posted On

2020-01-23