Incidental Mutation 'R8058:Zfp937'
ID619508
Institutional Source Beutler Lab
Gene Symbol Zfp937
Ensembl Gene ENSMUSG00000060336
Gene Namezinc finger protein 937
SynonymsGm4979
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R8058 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location150218073-150240725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150239501 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 484 (Y484N)
Ref Sequence ENSEMBL: ENSMUSP00000073454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073782]
Predicted Effect probably benign
Transcript: ENSMUST00000073782
AA Change: Y484N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000073454
Gene: ENSMUSG00000060336
AA Change: Y484N

DomainStartEndE-ValueType
KRAB 4 66 8.19e-20 SMART
ZnF_C2H2 103 125 1.28e-3 SMART
ZnF_C2H2 131 153 2.53e-2 SMART
ZnF_C2H2 159 181 9.58e-3 SMART
ZnF_C2H2 187 209 2.09e-3 SMART
ZnF_C2H2 215 237 2.2e-2 SMART
ZnF_C2H2 243 265 2.2e-2 SMART
ZnF_C2H2 271 293 2.2e-2 SMART
ZnF_C2H2 299 321 1.82e-3 SMART
ZnF_C2H2 327 349 3.69e-4 SMART
ZnF_C2H2 355 377 4.47e-3 SMART
ZnF_C2H2 383 405 3.89e-3 SMART
ZnF_C2H2 411 433 4.79e-3 SMART
ZnF_C2H2 439 461 8.47e-4 SMART
ZnF_C2H2 467 490 7.26e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,081,954 D769N possibly damaging Het
Abcb6 A G 1: 75,180,009 L37P possibly damaging Het
Abcg1 G T 17: 31,105,530 A250S probably benign Het
Acsf3 C T 8: 122,813,634 H524Y possibly damaging Het
Agbl4 A G 4: 110,660,842 K110R unknown Het
Arfgap2 G A 2: 91,266,299 probably null Het
B4galt4 T C 16: 38,766,021 probably null Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C8b A T 4: 104,790,614 D334V probably damaging Het
Capn11 T C 17: 45,643,755 Q152R probably null Het
Ccdc171 C A 4: 83,580,766 Q234K probably damaging Het
Clec2h A G 6: 128,674,003 D82G probably benign Het
Creld2 A G 15: 88,826,429 D349G probably damaging Het
D430041D05Rik A G 2: 104,148,783 *1415Q probably null Het
D430042O09Rik A G 7: 125,843,016 E725G probably benign Het
Dnmt3a T C 12: 3,902,768 V755A possibly damaging Het
Doc2a G T 7: 126,850,992 V201L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 G T 2: 125,351,969 D1359E possibly damaging Het
Fcnb T C 2: 28,079,695 Y120C probably damaging Het
Fras1 T A 5: 96,694,919 D1665E probably benign Het
Fry A T 5: 150,495,767 D524V Het
Garem1 A G 18: 21,148,564 L245P probably damaging Het
Gdf6 A G 4: 9,859,712 S265G probably benign Het
Gm5591 T C 7: 38,518,939 I837V probably benign Het
Gpr61 T C 3: 108,150,895 Y150C probably damaging Het
Grin2b A T 6: 135,733,227 L1107Q probably damaging Het
Helb A G 10: 120,105,578 S402P probably benign Het
Htt A G 5: 34,820,100 T777A probably benign Het
Iffo2 A G 4: 139,613,853 D383G probably benign Het
Ikzf3 G T 11: 98,516,927 Y29* probably null Het
Ints2 A T 11: 86,255,353 M143K probably benign Het
Jmjd1c T C 10: 67,254,495 V2292A not run Het
Lamb1 C A 12: 31,303,047 Q916K probably benign Het
Lrrtm4 G A 6: 80,022,545 M313I probably benign Het
Lum A G 10: 97,568,563 I107V probably benign Het
Ly6h T C 15: 75,565,212 E126G probably benign Het
Map3k5 G A 10: 20,132,114 V1230M probably damaging Het
Mcoln1 T C 8: 3,508,378 F211L probably benign Het
Mink1 G A 11: 70,603,768 W258* probably null Het
Muc16 G T 9: 18,660,002 S407* probably null Het
Ngef G A 1: 87,546,022 Q13* probably null Het
Nxpe5 T A 5: 138,239,311 Y44* probably null Het
Olfr1094 A G 2: 86,829,708 R319G probably benign Het
Olfr1098 C A 2: 86,922,807 A242S probably benign Het
Olfr1250 A G 2: 89,657,327 V38A probably benign Het
Olfr18 T A 9: 20,314,180 I247F probably damaging Het
Olfr270 T A 4: 52,971,106 L162M probably benign Het
Olfr938 A T 9: 39,078,566 Y60N probably damaging Het
Orc3 C A 4: 34,595,223 E249* probably null Het
Otogl A T 10: 107,762,426 C2288S probably damaging Het
Pde1b A G 15: 103,524,811 E249G probably damaging Het
Phf2 T C 13: 48,823,082 E219G unknown Het
Rbm19 T A 5: 120,140,375 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Sbk2 A G 7: 4,957,290 Y294H possibly damaging Het
Selenoo T C 15: 89,092,739 I198T possibly damaging Het
Sema3f T C 9: 107,682,601 E729G probably benign Het
Serpinb1b A T 13: 33,085,310 T9S probably benign Het
Sfxn4 T C 19: 60,844,252 T235A probably damaging Het
Shc4 A T 2: 125,649,234 Y461* probably null Het
Slc22a15 T C 3: 101,864,610 D391G probably benign Het
Slc22a23 G T 13: 34,305,184 Y239* probably null Het
Slc24a2 G A 4: 86,991,513 A656V probably damaging Het
Slc2a5 A T 4: 150,143,133 I470F probably damaging Het
Sptbn4 T C 7: 27,364,269 E2249G possibly damaging Het
Tas2r139 A T 6: 42,141,819 Q295L probably benign Het
Tdrd7 C A 4: 46,034,309 S1051R probably benign Het
Tmem2 C A 19: 21,852,331 A1268E probably benign Het
Tnfrsf18 G A 4: 156,028,345 A163T probably benign Het
Ube3b T C 5: 114,406,785 V596A possibly damaging Het
Vmn2r10 T A 5: 109,002,089 N363I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Yod1 C T 1: 130,719,069 Q228* probably null Het
Zfp433 A T 10: 81,720,290 K209* probably null Het
Zfp865 G A 7: 5,030,446 V477I probably benign Het
Zfp951 T G 5: 104,814,446 H418P probably damaging Het
Other mutations in Zfp937
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0350:Zfp937 UTSW 2 150239302 missense possibly damaging 0.91
R0449:Zfp937 UTSW 2 150239546 missense probably benign 0.13
R1403:Zfp937 UTSW 2 150238948 nonsense probably null
R1403:Zfp937 UTSW 2 150238948 nonsense probably null
R1465:Zfp937 UTSW 2 150239047 nonsense probably null
R1465:Zfp937 UTSW 2 150239047 nonsense probably null
R4510:Zfp937 UTSW 2 150238511 missense probably damaging 0.98
R4511:Zfp937 UTSW 2 150238511 missense probably damaging 0.98
R4689:Zfp937 UTSW 2 150236786 missense probably damaging 1.00
R5290:Zfp937 UTSW 2 150238309 nonsense probably null
R6287:Zfp937 UTSW 2 150238341 missense possibly damaging 0.89
R6701:Zfp937 UTSW 2 150239216 missense probably damaging 1.00
R6746:Zfp937 UTSW 2 150239423 nonsense probably null
R6838:Zfp937 UTSW 2 150239346 missense probably benign 0.01
R7162:Zfp937 UTSW 2 150239519 missense probably benign 0.35
R7213:Zfp937 UTSW 2 150239465 missense probably damaging 1.00
R7441:Zfp937 UTSW 2 150238710 frame shift probably null
R7481:Zfp937 UTSW 2 150239346 missense probably benign 0.01
R7694:Zfp937 UTSW 2 150239348 missense probably damaging 1.00
R7856:Zfp937 UTSW 2 150239547 missense probably benign 0.23
R7902:Zfp937 UTSW 2 150238761 missense probably damaging 1.00
R7956:Zfp937 UTSW 2 150239156 missense probably benign 0.03
R8468:Zfp937 UTSW 2 150238714 missense probably benign 0.02
X0017:Zfp937 UTSW 2 150218161 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGACCAATGTGATAAAGCCTTTGC -3'
(R):5'- CATTCATAGTTTCCCTCCAGTATGG -3'

Sequencing Primer
(F):5'- GCCTTTGCTCGAAACACTC -3'
(R):5'- GAAATGTACAAAGGCTTCACC -3'
Posted On2020-01-23