Incidental Mutation 'R8058:Ube3b'
ID619529
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Nameubiquitin protein ligase E3B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8058 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114380607-114421169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114406785 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 596 (V596A)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074002
AA Change: V596A

PolyPhen 2 Score 0.582 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: V596A

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,081,954 D769N possibly damaging Het
Abcb6 A G 1: 75,180,009 L37P possibly damaging Het
Abcg1 G T 17: 31,105,530 A250S probably benign Het
Acsf3 C T 8: 122,813,634 H524Y possibly damaging Het
Agbl4 A G 4: 110,660,842 K110R unknown Het
Arfgap2 G A 2: 91,266,299 probably null Het
B4galt4 T C 16: 38,766,021 probably null Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C8b A T 4: 104,790,614 D334V probably damaging Het
Capn11 T C 17: 45,643,755 Q152R probably null Het
Ccdc171 C A 4: 83,580,766 Q234K probably damaging Het
Clec2h A G 6: 128,674,003 D82G probably benign Het
Creld2 A G 15: 88,826,429 D349G probably damaging Het
D430041D05Rik A G 2: 104,148,783 *1415Q probably null Het
D430042O09Rik A G 7: 125,843,016 E725G probably benign Het
Dnmt3a T C 12: 3,902,768 V755A possibly damaging Het
Doc2a G T 7: 126,850,992 V201L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 G T 2: 125,351,969 D1359E possibly damaging Het
Fcnb T C 2: 28,079,695 Y120C probably damaging Het
Fras1 T A 5: 96,694,919 D1665E probably benign Het
Fry A T 5: 150,495,767 D524V Het
Garem1 A G 18: 21,148,564 L245P probably damaging Het
Gdf6 A G 4: 9,859,712 S265G probably benign Het
Gm5591 T C 7: 38,518,939 I837V probably benign Het
Gpr61 T C 3: 108,150,895 Y150C probably damaging Het
Grin2b A T 6: 135,733,227 L1107Q probably damaging Het
Helb A G 10: 120,105,578 S402P probably benign Het
Htt A G 5: 34,820,100 T777A probably benign Het
Iffo2 A G 4: 139,613,853 D383G probably benign Het
Ikzf3 G T 11: 98,516,927 Y29* probably null Het
Ints2 A T 11: 86,255,353 M143K probably benign Het
Jmjd1c T C 10: 67,254,495 V2292A not run Het
Lamb1 C A 12: 31,303,047 Q916K probably benign Het
Lrrtm4 G A 6: 80,022,545 M313I probably benign Het
Lum A G 10: 97,568,563 I107V probably benign Het
Ly6h T C 15: 75,565,212 E126G probably benign Het
Map3k5 G A 10: 20,132,114 V1230M probably damaging Het
Mcoln1 T C 8: 3,508,378 F211L probably benign Het
Mink1 G A 11: 70,603,768 W258* probably null Het
Muc16 G T 9: 18,660,002 S407* probably null Het
Ngef G A 1: 87,546,022 Q13* probably null Het
Nxpe5 T A 5: 138,239,311 Y44* probably null Het
Olfr1094 A G 2: 86,829,708 R319G probably benign Het
Olfr1098 C A 2: 86,922,807 A242S probably benign Het
Olfr1250 A G 2: 89,657,327 V38A probably benign Het
Olfr18 T A 9: 20,314,180 I247F probably damaging Het
Olfr270 T A 4: 52,971,106 L162M probably benign Het
Olfr938 A T 9: 39,078,566 Y60N probably damaging Het
Orc3 C A 4: 34,595,223 E249* probably null Het
Otogl A T 10: 107,762,426 C2288S probably damaging Het
Pde1b A G 15: 103,524,811 E249G probably damaging Het
Phf2 T C 13: 48,823,082 E219G unknown Het
Rbm19 T A 5: 120,140,375 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Sbk2 A G 7: 4,957,290 Y294H possibly damaging Het
Selenoo T C 15: 89,092,739 I198T possibly damaging Het
Sema3f T C 9: 107,682,601 E729G probably benign Het
Serpinb1b A T 13: 33,085,310 T9S probably benign Het
Sfxn4 T C 19: 60,844,252 T235A probably damaging Het
Shc4 A T 2: 125,649,234 Y461* probably null Het
Slc22a15 T C 3: 101,864,610 D391G probably benign Het
Slc22a23 G T 13: 34,305,184 Y239* probably null Het
Slc24a2 G A 4: 86,991,513 A656V probably damaging Het
Slc2a5 A T 4: 150,143,133 I470F probably damaging Het
Sptbn4 T C 7: 27,364,269 E2249G possibly damaging Het
Tas2r139 A T 6: 42,141,819 Q295L probably benign Het
Tdrd7 C A 4: 46,034,309 S1051R probably benign Het
Tmem2 C A 19: 21,852,331 A1268E probably benign Het
Tnfrsf18 G A 4: 156,028,345 A163T probably benign Het
Vmn2r10 T A 5: 109,002,089 N363I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Yod1 C T 1: 130,719,069 Q228* probably null Het
Zfp433 A T 10: 81,720,290 K209* probably null Het
Zfp865 G A 7: 5,030,446 V477I probably benign Het
Zfp937 T A 2: 150,239,501 Y484N probably benign Het
Zfp951 T G 5: 104,814,446 H418P probably damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 splice site probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2041:Ube3b UTSW 5 114387233 missense probably damaging 0.99
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R2205:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 splice site probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114415284 missense possibly damaging 0.79
R7438:Ube3b UTSW 5 114418626 missense probably damaging 1.00
R7640:Ube3b UTSW 5 114415323 missense probably benign
R7825:Ube3b UTSW 5 114401312 missense probably damaging 1.00
R7958:Ube3b UTSW 5 114401423 missense probably benign 0.05
R8025:Ube3b UTSW 5 114408209 missense probably damaging 0.99
R8087:Ube3b UTSW 5 114412489 critical splice donor site probably null
R8182:Ube3b UTSW 5 114392138 missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114402686 missense probably benign 0.04
R8465:Ube3b UTSW 5 114390390 missense probably damaging 1.00
R8682:Ube3b UTSW 5 114412290 missense probably damaging 1.00
R8708:Ube3b UTSW 5 114393090 missense probably benign 0.34
R8758:Ube3b UTSW 5 114415200 critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114388739 missense probably damaging 1.00
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GTGCATTCCCTCAAAGATACCC -3'
(R):5'- TGCCCAGACAGGAGCTTAAAC -3'

Sequencing Primer
(F):5'- AGATACCCAGGCCCTAAGG -3'
(R):5'- TTCTTTCCAGACAAACGGACAGG -3'
Posted On2020-01-23