Incidental Mutation 'R8058:Fry'
ID619532
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R8058 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150495767 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 524 (D524V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000202566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087204
AA Change: D2892V

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: D2892V

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000202566
AA Change: D888V

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144657
Gene: ENSMUSG00000056602
AA Change: D888V

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_C 37 290 1.5e-71 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 447 472 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 832 848 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,081,954 D769N possibly damaging Het
Abcb6 A G 1: 75,180,009 L37P possibly damaging Het
Abcg1 G T 17: 31,105,530 A250S probably benign Het
Acsf3 C T 8: 122,813,634 H524Y possibly damaging Het
Agbl4 A G 4: 110,660,842 K110R unknown Het
Arfgap2 G A 2: 91,266,299 probably null Het
B4galt4 T C 16: 38,766,021 probably null Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C8b A T 4: 104,790,614 D334V probably damaging Het
Capn11 T C 17: 45,643,755 Q152R probably null Het
Ccdc171 C A 4: 83,580,766 Q234K probably damaging Het
Clec2h A G 6: 128,674,003 D82G probably benign Het
Creld2 A G 15: 88,826,429 D349G probably damaging Het
D430041D05Rik A G 2: 104,148,783 *1415Q probably null Het
D430042O09Rik A G 7: 125,843,016 E725G probably benign Het
Dnmt3a T C 12: 3,902,768 V755A possibly damaging Het
Doc2a G T 7: 126,850,992 V201L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 G T 2: 125,351,969 D1359E possibly damaging Het
Fcnb T C 2: 28,079,695 Y120C probably damaging Het
Fras1 T A 5: 96,694,919 D1665E probably benign Het
Garem1 A G 18: 21,148,564 L245P probably damaging Het
Gdf6 A G 4: 9,859,712 S265G probably benign Het
Gm5591 T C 7: 38,518,939 I837V probably benign Het
Gpr61 T C 3: 108,150,895 Y150C probably damaging Het
Grin2b A T 6: 135,733,227 L1107Q probably damaging Het
Helb A G 10: 120,105,578 S402P probably benign Het
Htt A G 5: 34,820,100 T777A probably benign Het
Iffo2 A G 4: 139,613,853 D383G probably benign Het
Ikzf3 G T 11: 98,516,927 Y29* probably null Het
Ints2 A T 11: 86,255,353 M143K probably benign Het
Jmjd1c T C 10: 67,254,495 V2292A not run Het
Lamb1 C A 12: 31,303,047 Q916K probably benign Het
Lrrtm4 G A 6: 80,022,545 M313I probably benign Het
Lum A G 10: 97,568,563 I107V probably benign Het
Ly6h T C 15: 75,565,212 E126G probably benign Het
Map3k5 G A 10: 20,132,114 V1230M probably damaging Het
Mcoln1 T C 8: 3,508,378 F211L probably benign Het
Mink1 G A 11: 70,603,768 W258* probably null Het
Muc16 G T 9: 18,660,002 S407* probably null Het
Ngef G A 1: 87,546,022 Q13* probably null Het
Nxpe5 T A 5: 138,239,311 Y44* probably null Het
Olfr1094 A G 2: 86,829,708 R319G probably benign Het
Olfr1098 C A 2: 86,922,807 A242S probably benign Het
Olfr1250 A G 2: 89,657,327 V38A probably benign Het
Olfr18 T A 9: 20,314,180 I247F probably damaging Het
Olfr270 T A 4: 52,971,106 L162M probably benign Het
Olfr938 A T 9: 39,078,566 Y60N probably damaging Het
Orc3 C A 4: 34,595,223 E249* probably null Het
Otogl A T 10: 107,762,426 C2288S probably damaging Het
Pde1b A G 15: 103,524,811 E249G probably damaging Het
Phf2 T C 13: 48,823,082 E219G unknown Het
Rbm19 T A 5: 120,140,375 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Sbk2 A G 7: 4,957,290 Y294H possibly damaging Het
Selenoo T C 15: 89,092,739 I198T possibly damaging Het
Sema3f T C 9: 107,682,601 E729G probably benign Het
Serpinb1b A T 13: 33,085,310 T9S probably benign Het
Sfxn4 T C 19: 60,844,252 T235A probably damaging Het
Shc4 A T 2: 125,649,234 Y461* probably null Het
Slc22a15 T C 3: 101,864,610 D391G probably benign Het
Slc22a23 G T 13: 34,305,184 Y239* probably null Het
Slc24a2 G A 4: 86,991,513 A656V probably damaging Het
Slc2a5 A T 4: 150,143,133 I470F probably damaging Het
Sptbn4 T C 7: 27,364,269 E2249G possibly damaging Het
Tas2r139 A T 6: 42,141,819 Q295L probably benign Het
Tdrd7 C A 4: 46,034,309 S1051R probably benign Het
Tmem2 C A 19: 21,852,331 A1268E probably benign Het
Tnfrsf18 G A 4: 156,028,345 A163T probably benign Het
Ube3b T C 5: 114,406,785 V596A possibly damaging Het
Vmn2r10 T A 5: 109,002,089 N363I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Yod1 C T 1: 130,719,069 Q228* probably null Het
Zfp433 A T 10: 81,720,290 K209* probably null Het
Zfp865 G A 7: 5,030,446 V477I probably benign Het
Zfp937 T A 2: 150,239,501 Y484N probably benign Het
Zfp951 T G 5: 104,814,446 H418P probably damaging Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
R7487:Fry UTSW 5 150414574 missense possibly damaging 0.79
R7491:Fry UTSW 5 150466326 missense
R7574:Fry UTSW 5 150380894 missense probably benign 0.00
R7582:Fry UTSW 5 150496382 missense
R7586:Fry UTSW 5 150426218 missense probably damaging 1.00
R7650:Fry UTSW 5 150413418 missense probably damaging 1.00
R7699:Fry UTSW 5 150405327 missense probably damaging 0.98
R7700:Fry UTSW 5 150405327 missense probably damaging 0.98
R8070:Fry UTSW 5 150478007 missense
Z1177:Fry UTSW 5 150310437 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACACTTGCCAATGGGGTTTTG -3'
(R):5'- AAGGATTAAGTCTGTGTTTCCCAC -3'

Sequencing Primer
(F):5'- TAACCTCACTGGGTAGCCTAG -3'
(R):5'- GTGTTTCCCACAAGCGCC -3'
Posted On2020-01-23