Incidental Mutation 'R8058:Grin2b'
ID619537
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8058 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135733227 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1107 (L1107Q)
Ref Sequence ENSEMBL: ENSMUSP00000062284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: L1107Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: L1107Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: L1107Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: L1107Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,081,954 D769N possibly damaging Het
Abcb6 A G 1: 75,180,009 L37P possibly damaging Het
Abcg1 G T 17: 31,105,530 A250S probably benign Het
Acsf3 C T 8: 122,813,634 H524Y possibly damaging Het
Agbl4 A G 4: 110,660,842 K110R unknown Het
Arfgap2 G A 2: 91,266,299 probably null Het
B4galt4 T C 16: 38,766,021 probably null Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C8b A T 4: 104,790,614 D334V probably damaging Het
Capn11 T C 17: 45,643,755 Q152R probably null Het
Ccdc171 C A 4: 83,580,766 Q234K probably damaging Het
Clec2h A G 6: 128,674,003 D82G probably benign Het
Creld2 A G 15: 88,826,429 D349G probably damaging Het
D430041D05Rik A G 2: 104,148,783 *1415Q probably null Het
D430042O09Rik A G 7: 125,843,016 E725G probably benign Het
Dnmt3a T C 12: 3,902,768 V755A possibly damaging Het
Doc2a G T 7: 126,850,992 V201L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 G T 2: 125,351,969 D1359E possibly damaging Het
Fcnb T C 2: 28,079,695 Y120C probably damaging Het
Fras1 T A 5: 96,694,919 D1665E probably benign Het
Fry A T 5: 150,495,767 D524V Het
Garem1 A G 18: 21,148,564 L245P probably damaging Het
Gdf6 A G 4: 9,859,712 S265G probably benign Het
Gm5591 T C 7: 38,518,939 I837V probably benign Het
Gpr61 T C 3: 108,150,895 Y150C probably damaging Het
Helb A G 10: 120,105,578 S402P probably benign Het
Htt A G 5: 34,820,100 T777A probably benign Het
Iffo2 A G 4: 139,613,853 D383G probably benign Het
Ikzf3 G T 11: 98,516,927 Y29* probably null Het
Ints2 A T 11: 86,255,353 M143K probably benign Het
Jmjd1c T C 10: 67,254,495 V2292A not run Het
Lamb1 C A 12: 31,303,047 Q916K probably benign Het
Lrrtm4 G A 6: 80,022,545 M313I probably benign Het
Lum A G 10: 97,568,563 I107V probably benign Het
Ly6h T C 15: 75,565,212 E126G probably benign Het
Map3k5 G A 10: 20,132,114 V1230M probably damaging Het
Mcoln1 T C 8: 3,508,378 F211L probably benign Het
Mink1 G A 11: 70,603,768 W258* probably null Het
Muc16 G T 9: 18,660,002 S407* probably null Het
Ngef G A 1: 87,546,022 Q13* probably null Het
Nxpe5 T A 5: 138,239,311 Y44* probably null Het
Olfr1094 A G 2: 86,829,708 R319G probably benign Het
Olfr1098 C A 2: 86,922,807 A242S probably benign Het
Olfr1250 A G 2: 89,657,327 V38A probably benign Het
Olfr18 T A 9: 20,314,180 I247F probably damaging Het
Olfr270 T A 4: 52,971,106 L162M probably benign Het
Olfr938 A T 9: 39,078,566 Y60N probably damaging Het
Orc3 C A 4: 34,595,223 E249* probably null Het
Otogl A T 10: 107,762,426 C2288S probably damaging Het
Pde1b A G 15: 103,524,811 E249G probably damaging Het
Phf2 T C 13: 48,823,082 E219G unknown Het
Rbm19 T A 5: 120,140,375 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Sbk2 A G 7: 4,957,290 Y294H possibly damaging Het
Selenoo T C 15: 89,092,739 I198T possibly damaging Het
Sema3f T C 9: 107,682,601 E729G probably benign Het
Serpinb1b A T 13: 33,085,310 T9S probably benign Het
Sfxn4 T C 19: 60,844,252 T235A probably damaging Het
Shc4 A T 2: 125,649,234 Y461* probably null Het
Slc22a15 T C 3: 101,864,610 D391G probably benign Het
Slc22a23 G T 13: 34,305,184 Y239* probably null Het
Slc24a2 G A 4: 86,991,513 A656V probably damaging Het
Slc2a5 A T 4: 150,143,133 I470F probably damaging Het
Sptbn4 T C 7: 27,364,269 E2249G possibly damaging Het
Tas2r139 A T 6: 42,141,819 Q295L probably benign Het
Tdrd7 C A 4: 46,034,309 S1051R probably benign Het
Tmem2 C A 19: 21,852,331 A1268E probably benign Het
Tnfrsf18 G A 4: 156,028,345 A163T probably benign Het
Ube3b T C 5: 114,406,785 V596A possibly damaging Het
Vmn2r10 T A 5: 109,002,089 N363I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Yod1 C T 1: 130,719,069 Q228* probably null Het
Zfp433 A T 10: 81,720,290 K209* probably null Het
Zfp865 G A 7: 5,030,446 V477I probably benign Het
Zfp937 T A 2: 150,239,501 Y484N probably benign Het
Zfp951 T G 5: 104,814,446 H418P probably damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCGTGTTTAAGGTGAGACC -3'
(R):5'- ACAGTGGCCATGATGACTTG -3'

Sequencing Primer
(F):5'- TGACCGAATCTCGCTTGAAG -3'
(R):5'- GCCATGATGACTTGATTCGATCAG -3'
Posted On2020-01-23