Incidental Mutation 'R8058:Sptbn4'
ID619540
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Namespectrin beta, non-erythrocytic 4
SynonymsROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R8058 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27356383-27447686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27364269 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2249 (E2249G)
Ref Sequence ENSEMBL: ENSMUSP00000011895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
Predicted Effect possibly damaging
Transcript: ENSMUST00000011895
AA Change: E2249G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: E2249G

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108362
AA Change: E929G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: E929G

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108363
AA Change: E929G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: E929G

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108364
AA Change: E929G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: E929G

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172269
AA Change: E2244G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: E2244G

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,081,954 D769N possibly damaging Het
Abcb6 A G 1: 75,180,009 L37P possibly damaging Het
Abcg1 G T 17: 31,105,530 A250S probably benign Het
Acsf3 C T 8: 122,813,634 H524Y possibly damaging Het
Agbl4 A G 4: 110,660,842 K110R unknown Het
Arfgap2 G A 2: 91,266,299 probably null Het
B4galt4 T C 16: 38,766,021 probably null Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C8b A T 4: 104,790,614 D334V probably damaging Het
Capn11 T C 17: 45,643,755 Q152R probably null Het
Ccdc171 C A 4: 83,580,766 Q234K probably damaging Het
Clec2h A G 6: 128,674,003 D82G probably benign Het
Creld2 A G 15: 88,826,429 D349G probably damaging Het
D430041D05Rik A G 2: 104,148,783 *1415Q probably null Het
D430042O09Rik A G 7: 125,843,016 E725G probably benign Het
Dnmt3a T C 12: 3,902,768 V755A possibly damaging Het
Doc2a G T 7: 126,850,992 V201L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 G T 2: 125,351,969 D1359E possibly damaging Het
Fcnb T C 2: 28,079,695 Y120C probably damaging Het
Fras1 T A 5: 96,694,919 D1665E probably benign Het
Fry A T 5: 150,495,767 D524V Het
Garem1 A G 18: 21,148,564 L245P probably damaging Het
Gdf6 A G 4: 9,859,712 S265G probably benign Het
Gm5591 T C 7: 38,518,939 I837V probably benign Het
Gpr61 T C 3: 108,150,895 Y150C probably damaging Het
Grin2b A T 6: 135,733,227 L1107Q probably damaging Het
Helb A G 10: 120,105,578 S402P probably benign Het
Htt A G 5: 34,820,100 T777A probably benign Het
Iffo2 A G 4: 139,613,853 D383G probably benign Het
Ikzf3 G T 11: 98,516,927 Y29* probably null Het
Ints2 A T 11: 86,255,353 M143K probably benign Het
Jmjd1c T C 10: 67,254,495 V2292A not run Het
Lamb1 C A 12: 31,303,047 Q916K probably benign Het
Lrrtm4 G A 6: 80,022,545 M313I probably benign Het
Lum A G 10: 97,568,563 I107V probably benign Het
Ly6h T C 15: 75,565,212 E126G probably benign Het
Map3k5 G A 10: 20,132,114 V1230M probably damaging Het
Mcoln1 T C 8: 3,508,378 F211L probably benign Het
Mink1 G A 11: 70,603,768 W258* probably null Het
Muc16 G T 9: 18,660,002 S407* probably null Het
Ngef G A 1: 87,546,022 Q13* probably null Het
Nxpe5 T A 5: 138,239,311 Y44* probably null Het
Olfr1094 A G 2: 86,829,708 R319G probably benign Het
Olfr1098 C A 2: 86,922,807 A242S probably benign Het
Olfr1250 A G 2: 89,657,327 V38A probably benign Het
Olfr18 T A 9: 20,314,180 I247F probably damaging Het
Olfr270 T A 4: 52,971,106 L162M probably benign Het
Olfr938 A T 9: 39,078,566 Y60N probably damaging Het
Orc3 C A 4: 34,595,223 E249* probably null Het
Otogl A T 10: 107,762,426 C2288S probably damaging Het
Pde1b A G 15: 103,524,811 E249G probably damaging Het
Phf2 T C 13: 48,823,082 E219G unknown Het
Rbm19 T A 5: 120,140,375 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Sbk2 A G 7: 4,957,290 Y294H possibly damaging Het
Selenoo T C 15: 89,092,739 I198T possibly damaging Het
Sema3f T C 9: 107,682,601 E729G probably benign Het
Serpinb1b A T 13: 33,085,310 T9S probably benign Het
Sfxn4 T C 19: 60,844,252 T235A probably damaging Het
Shc4 A T 2: 125,649,234 Y461* probably null Het
Slc22a15 T C 3: 101,864,610 D391G probably benign Het
Slc22a23 G T 13: 34,305,184 Y239* probably null Het
Slc24a2 G A 4: 86,991,513 A656V probably damaging Het
Slc2a5 A T 4: 150,143,133 I470F probably damaging Het
Tas2r139 A T 6: 42,141,819 Q295L probably benign Het
Tdrd7 C A 4: 46,034,309 S1051R probably benign Het
Tmem2 C A 19: 21,852,331 A1268E probably benign Het
Tnfrsf18 G A 4: 156,028,345 A163T probably benign Het
Ube3b T C 5: 114,406,785 V596A possibly damaging Het
Vmn2r10 T A 5: 109,002,089 N363I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Yod1 C T 1: 130,719,069 Q228* probably null Het
Zfp433 A T 10: 81,720,290 K209* probably null Het
Zfp865 G A 7: 5,030,446 V477I probably benign Het
Zfp937 T A 2: 150,239,501 Y484N probably benign Het
Zfp951 T G 5: 104,814,446 H418P probably damaging Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27369434 missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27417965 missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27414771 missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27404268 missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27364146 missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27364515 missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27364357 missense probably benign
IGL02226:Sptbn4 APN 7 27365707 missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27364299 missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27428247 missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27365589 missense probably null 0.15
IGL02487:Sptbn4 APN 7 27419097 missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27391551 missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27367679 missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27394148 splice site probably benign
IGL02961:Sptbn4 APN 7 27397967 missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27357387 nonsense probably null
R0194:Sptbn4 UTSW 7 27404911 missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27364170 missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27359736 splice site probably benign
R0510:Sptbn4 UTSW 7 27361566 critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27364378 missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27408328 nonsense probably null
R1336:Sptbn4 UTSW 7 27417963 missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27434294 missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27418739 missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27418583 missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27366646 missense probably null 0.96
R1906:Sptbn4 UTSW 7 27391431 critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27407138 missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27366443 missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27423810 missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27366419 nonsense probably null
R2083:Sptbn4 UTSW 7 27428256 missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27364162 missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27367609 missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27360092 missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27418098 nonsense probably null
R4115:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27418471 missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27423798 missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27364419 missense probably damaging 0.96
R4684:Sptbn4 UTSW 7 27366735 missense possibly damaging 0.60
R4707:Sptbn4 UTSW 7 27417006 missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27372152 missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27369391 missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27359741 critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27366428 missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27418713 missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27404253 missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27372171 missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27418599 missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27364479 missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27360088 missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27364587 nonsense probably null
R6762:Sptbn4 UTSW 7 27394208 missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27371950 missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27418056 missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27416785 missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27366689 missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27409014 missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27428268 missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27375590 missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27442535 missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27372272 missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27361577 missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27364336 missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27361634 missense possibly damaging 0.70
R7854:Sptbn4 UTSW 7 27362410 missense probably benign
R8002:Sptbn4 UTSW 7 27417992 missense possibly damaging 0.91
R8181:Sptbn4 UTSW 7 27375383 missense possibly damaging 0.79
R8195:Sptbn4 UTSW 7 27408889 nonsense probably null
R8353:Sptbn4 UTSW 7 27404238 missense probably damaging 1.00
R8392:Sptbn4 UTSW 7 27372296 missense probably damaging 1.00
R8453:Sptbn4 UTSW 7 27404238 missense probably damaging 1.00
R8815:Sptbn4 UTSW 7 27407232 nonsense probably null
R8818:Sptbn4 UTSW 7 27364167 missense possibly damaging 0.71
X0020:Sptbn4 UTSW 7 27402734 critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27357311 unclassified probably benign
Z1176:Sptbn4 UTSW 7 27360025 missense probably damaging 0.99
Z1177:Sptbn4 UTSW 7 27404582 missense probably damaging 1.00
Z1177:Sptbn4 UTSW 7 27409102 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GAGTCTCCTGTTCGCTAGACTC -3'
(R):5'- ACTGGGGCGCAAGTTCTTTG -3'

Sequencing Primer
(F):5'- CTGTTCGCTAGACTCCTGTC -3'
(R):5'- TATGTGCGCCAGGAGCTCAAG -3'
Posted On2020-01-23