Mutagenetix > Incidental Mutation

Incidental Mutation 'R8058:Mink1'

619557

Institutional Source

Beutler Lab

Gene Symbol

Mink1

Ensembl Gene

ENSMUSG00000020827

Gene Name

misshapen-like kinase 1 (zebrafish)

Synonyms

Map4k6, Ysk2, MINK, Misshapen/NIKs-related kinase

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8058 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70562881-70614483 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 70603768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 258 (W258*)

Ref Sequence

ENSEMBL: ENSMUSP00000099619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]

AlphaFold

Q9JM52

Predicted Effect

probably null
Transcript: ENSMUST00000072237
AA Change: W258*

SMART Domains

Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: W258*

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC
low complexity region	837	874	N/A	INTRINSIC
CNH	1026	1324	1.58e-113	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000072873
AA Change: W258*

SMART Domains

Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: W258*

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC
low complexity region	829	853	N/A	INTRINSIC
CNH	1019	1317	1.58e-113	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000079244
AA Change: W258*

SMART Domains

Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: W258*

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	314	338	N/A	INTRINSIC
coiled coil region	348	493	N/A	INTRINSIC
low complexity region	554	566	N/A	INTRINSIC
low complexity region	617	630	N/A	INTRINSIC
low complexity region	643	656	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	826	850	N/A	INTRINSIC
CNH	1016	1314	1.58e-113	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102558
AA Change: W258*

SMART Domains

Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: W258*

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	792	816	N/A	INTRINSIC
CNH	982	1280	1.58e-113	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102559
AA Change: W258*

SMART Domains

Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: W258*

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	800	824	N/A	INTRINSIC
CNH	990	1288	1.58e-113	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000136663
AA Change: W111*

SMART Domains

Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: W111*

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	1	140	2.3e-22	PFAM
Pfam:Pkinase	1	143	1.6e-30	PFAM
low complexity region	161	192	N/A	INTRINSIC
coiled coil region	204	349	N/A	INTRINSIC
low complexity region	411	423	N/A	INTRINSIC
low complexity region	474	487	N/A	INTRINSIC
low complexity region	500	513	N/A	INTRINSIC
low complexity region	573	592	N/A	INTRINSIC
low complexity region	691	728	N/A	INTRINSIC
CNH	880	1178	1.58e-113	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149845

Predicted Effect

probably benign
Transcript: ENSMUST00000178764

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	C	T	4: 53,081,954	D769N	possibly damaging	Het
Abcb6	A	G	1: 75,180,009	L37P	possibly damaging	Het
Abcg1	G	T	17: 31,105,530	A250S	probably benign	Het
Acsf3	C	T	8: 122,813,634	H524Y	possibly damaging	Het
Agbl4	A	G	4: 110,660,842	K110R	unknown	Het
Arfgap2	G	A	2: 91,266,299		probably null	Het
B4galt4	T	C	16: 38,766,021		probably null	Het
Bex6	G	T	16: 32,186,406	D11Y	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
C8b	A	T	4: 104,790,614	D334V	probably damaging	Het
Capn11	T	C	17: 45,643,755	Q152R	probably null	Het
Ccdc171	C	A	4: 83,580,766	Q234K	probably damaging	Het
Clec2h	A	G	6: 128,674,003	D82G	probably benign	Het
Creld2	A	G	15: 88,826,429	D349G	probably damaging	Het
D430041D05Rik	A	G	2: 104,148,783	*1415Q	probably null	Het
D430042O09Rik	A	G	7: 125,843,016	E725G	probably benign	Het
Dnmt3a	T	C	12: 3,902,768	V755A	possibly damaging	Het
Doc2a	G	T	7: 126,850,992	V201L	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbn1	G	T	2: 125,351,969	D1359E	possibly damaging	Het
Fcnb	T	C	2: 28,079,695	Y120C	probably damaging	Het
Fras1	T	A	5: 96,694,919	D1665E	probably benign	Het
Fry	A	T	5: 150,495,767	D524V		Het
Garem1	A	G	18: 21,148,564	L245P	probably damaging	Het
Gdf6	A	G	4: 9,859,712	S265G	probably benign	Het
Gm5591	T	C	7: 38,518,939	I837V	probably benign	Het
Gpr61	T	C	3: 108,150,895	Y150C	probably damaging	Het
Grin2b	A	T	6: 135,733,227	L1107Q	probably damaging	Het
Helb	A	G	10: 120,105,578	S402P	probably benign	Het
Htt	A	G	5: 34,820,100	T777A	probably benign	Het
Iffo2	A	G	4: 139,613,853	D383G	probably benign	Het
Ikzf3	G	T	11: 98,516,927	Y29*	probably null	Het
Ints2	A	T	11: 86,255,353	M143K	probably benign	Het
Jmjd1c	T	C	10: 67,254,495	V2292A	not run	Het
Lamb1	C	A	12: 31,303,047	Q916K	probably benign	Het
Lrrtm4	G	A	6: 80,022,545	M313I	probably benign	Het
Lum	A	G	10: 97,568,563	I107V	probably benign	Het
Ly6h	T	C	15: 75,565,212	E126G	probably benign	Het
Map3k5	G	A	10: 20,132,114	V1230M	probably damaging	Het
Mcoln1	T	C	8: 3,508,378	F211L	probably benign	Het
Muc16	G	T	9: 18,660,002	S407*	probably null	Het
Ngef	G	A	1: 87,546,022	Q13*	probably null	Het
Nxpe5	T	A	5: 138,239,311	Y44*	probably null	Het
Olfr1094	A	G	2: 86,829,708	R319G	probably benign	Het
Olfr1098	C	A	2: 86,922,807	A242S	probably benign	Het
Olfr1250	A	G	2: 89,657,327	V38A	probably benign	Het
Olfr18	T	A	9: 20,314,180	I247F	probably damaging	Het
Olfr270	T	A	4: 52,971,106	L162M	probably benign	Het
Olfr938	A	T	9: 39,078,566	Y60N	probably damaging	Het
Orc3	C	A	4: 34,595,223	E249*	probably null	Het
Otogl	A	T	10: 107,762,426	C2288S	probably damaging	Het
Pde1b	A	G	15: 103,524,811	E249G	probably damaging	Het
Phf2	T	C	13: 48,823,082	E219G	unknown	Het
Rbm19	T	A	5: 120,140,375		probably null	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Het
Sbk2	A	G	7: 4,957,290	Y294H	possibly damaging	Het
Selenoo	T	C	15: 89,092,739	I198T	possibly damaging	Het
Sema3f	T	C	9: 107,682,601	E729G	probably benign	Het
Serpinb1b	A	T	13: 33,085,310	T9S	probably benign	Het
Sfxn4	T	C	19: 60,844,252	T235A	probably damaging	Het
Shc4	A	T	2: 125,649,234	Y461*	probably null	Het
Slc22a15	T	C	3: 101,864,610	D391G	probably benign	Het
Slc22a23	G	T	13: 34,305,184	Y239*	probably null	Het
Slc24a2	G	A	4: 86,991,513	A656V	probably damaging	Het
Slc2a5	A	T	4: 150,143,133	I470F	probably damaging	Het
Sptbn4	T	C	7: 27,364,269	E2249G	possibly damaging	Het
Tas2r139	A	T	6: 42,141,819	Q295L	probably benign	Het
Tdrd7	C	A	4: 46,034,309	S1051R	probably benign	Het
Tmem2	C	A	19: 21,852,331	A1268E	probably benign	Het
Tnfrsf18	G	A	4: 156,028,345	A163T	probably benign	Het
Ube3b	T	C	5: 114,406,785	V596A	possibly damaging	Het
Vmn2r10	T	A	5: 109,002,089	N363I	probably benign	Het
Vmn2r15	T	A	5: 109,293,090	I301F	probably damaging	Het
Yod1	C	T	1: 130,719,069	Q228*	probably null	Het
Zfp433	A	T	10: 81,720,290	K209*	probably null	Het
Zfp865	G	A	7: 5,030,446	V477I	probably benign	Het
Zfp937	T	A	2: 150,239,501	Y484N	probably benign	Het
Zfp951	T	G	5: 104,814,446	H418P	probably damaging	Het

Other mutations in Mink1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Mink1	APN	11	70603812	missense	probably damaging	0.99
IGL00709:Mink1	APN	11	70613019	missense	probably damaging	0.99
IGL01064:Mink1	APN	11	70603481	missense	probably benign	0.05
IGL02612:Mink1	APN	11	70597226	missense	probably damaging	1.00
IGL02797:Mink1	APN	11	70610350	missense	probably damaging	1.00
IGL03056:Mink1	APN	11	70612583	critical splice donor site	probably null
IGL03066:Mink1	APN	11	70608889	missense	probably benign	0.01
IGL03185:Mink1	APN	11	70603860	missense	probably damaging	1.00
PIT4498001:Mink1	UTSW	11	70598888	missense	probably benign	0.05
R0025:Mink1	UTSW	11	70613042	missense	probably damaging	1.00
R0025:Mink1	UTSW	11	70613042	missense	probably damaging	1.00
R0488:Mink1	UTSW	11	70597204	missense	probably damaging	1.00
R0637:Mink1	UTSW	11	70601676	missense	probably damaging	0.96
R0828:Mink1	UTSW	11	70610145	nonsense	probably null
R1081:Mink1	UTSW	11	70607035	missense	probably benign	0.07
R1175:Mink1	UTSW	11	70611340	missense	probably benign	0.02
R1441:Mink1	UTSW	11	70607114	missense	possibly damaging	0.72
R1532:Mink1	UTSW	11	70602007	missense	probably null	1.00
R1545:Mink1	UTSW	11	70598891	missense	possibly damaging	0.60
R1634:Mink1	UTSW	11	70608880	missense	probably benign	0.00
R1932:Mink1	UTSW	11	70608428	critical splice donor site	probably null
R2033:Mink1	UTSW	11	70612508	missense	probably damaging	1.00
R2184:Mink1	UTSW	11	70603797	missense	probably damaging	1.00
R2267:Mink1	UTSW	11	70601724	splice site	probably null
R2268:Mink1	UTSW	11	70601724	splice site	probably null
R2859:Mink1	UTSW	11	70612508	missense	probably damaging	1.00
R3713:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3714:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3715:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3716:Mink1	UTSW	11	70607761	missense	probably damaging	0.98
R3717:Mink1	UTSW	11	70607761	missense	probably damaging	0.98
R4607:Mink1	UTSW	11	70606067	missense	possibly damaging	0.72
R4735:Mink1	UTSW	11	70609260	splice site	probably null
R4790:Mink1	UTSW	11	70599041	missense	probably damaging	0.99
R4847:Mink1	UTSW	11	70602028	missense	probably damaging	1.00
R4860:Mink1	UTSW	11	70611592	missense	probably damaging	0.98
R4860:Mink1	UTSW	11	70611592	missense	probably damaging	0.98
R5081:Mink1	UTSW	11	70605144	missense	probably damaging	0.98
R5310:Mink1	UTSW	11	70607343	missense	probably benign	0.33
R5677:Mink1	UTSW	11	70605165	missense	possibly damaging	0.66
R5767:Mink1	UTSW	11	70606075	missense	possibly damaging	0.53
R5795:Mink1	UTSW	11	70607790	missense	possibly damaging	0.86
R5888:Mink1	UTSW	11	70610059	unclassified	probably benign
R5950:Mink1	UTSW	11	70609586	missense	possibly damaging	0.81
R6024:Mink1	UTSW	11	70599089	missense	possibly damaging	0.71
R6034:Mink1	UTSW	11	70607040	small deletion	probably benign
R6034:Mink1	UTSW	11	70607040	small deletion	probably benign
R6058:Mink1	UTSW	11	70611720	missense	possibly damaging	0.96
R6144:Mink1	UTSW	11	70610652	missense	possibly damaging	0.66
R6154:Mink1	UTSW	11	70610101	missense	possibly damaging	0.46
R6218:Mink1	UTSW	11	70598894	missense	possibly damaging	0.94
R6262:Mink1	UTSW	11	70603325	splice site	probably null
R6269:Mink1	UTSW	11	70598987	missense	probably damaging	1.00
R6273:Mink1	UTSW	11	70611435	nonsense	probably null
R6301:Mink1	UTSW	11	70612294	missense	possibly damaging	0.71
R6603:Mink1	UTSW	11	70609593	missense	probably damaging	0.96
R6876:Mink1	UTSW	11	70607435	missense	probably benign	0.02
R7030:Mink1	UTSW	11	70607775	missense	possibly damaging	0.46
R7050:Mink1	UTSW	11	70612332	missense	possibly damaging	0.93
R7094:Mink1	UTSW	11	70610075	splice site	probably null
R7135:Mink1	UTSW	11	70603503	missense	probably damaging	1.00
R7238:Mink1	UTSW	11	70611479	critical splice donor site	probably null
R7320:Mink1	UTSW	11	70599073	missense	probably benign	0.23
R7396:Mink1	UTSW	11	70605168	missense	possibly damaging	0.73
R7446:Mink1	UTSW	11	70609629	missense	probably benign	0.18
R7723:Mink1	UTSW	11	70612910	missense	probably benign	0.16
R7896:Mink1	UTSW	11	70612282	missense	possibly damaging	0.71
R8082:Mink1	UTSW	11	70613277	missense	possibly damaging	0.71
R8160:Mink1	UTSW	11	70606081	nonsense	probably null
R8335:Mink1	UTSW	11	70609575	missense	probably damaging	0.97
R8353:Mink1	UTSW	11	70610328	missense	possibly damaging	0.70
R8453:Mink1	UTSW	11	70610328	missense	possibly damaging	0.70
R8732:Mink1	UTSW	11	70610076	critical splice acceptor site	probably null
R9072:Mink1	UTSW	11	70608381	missense	possibly damaging	0.86
R9073:Mink1	UTSW	11	70608381	missense	possibly damaging	0.86
R9324:Mink1	UTSW	11	70611651	missense	probably damaging	0.98
R9596:Mink1	UTSW	11	70607089	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGTCAGGGAAGGCTTCTAGG -3'
(R):5'- TCCAGAGATCTCACGGCTAG -3'

Sequencing Primer
(F):5'- AAGGCTTCTAGGGCAGGGC -3'
(R):5'- TCTCACGGCTAGAGAGGG -3'

Posted On

2020-01-23