Mutagenetix > Incidental Mutation

Incidental Mutation 'R8058:Ints2'

619558

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8058 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86255353 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 143 (M143K)

Ref Sequence

ENSEMBL: ENSMUSP00000018212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000132024] [ENSMUST00000136469] [ENSMUST00000139285]

AlphaFold

Q80UK8

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: M143K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: M143K

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: M143K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: M143K

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132024

SMART Domains

Protein: ENSMUSP00000114859
Gene: ENSMUSG00000018068

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	140	1e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136469

SMART Domains

Protein: ENSMUSP00000116633
Gene: ENSMUSG00000018068

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	98	6.5e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139285
AA Change: M143K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068
AA Change: M143K

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	190	1.4e-69	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	C	T	4: 53,081,954	D769N	possibly damaging	Het
Abcb6	A	G	1: 75,180,009	L37P	possibly damaging	Het
Abcg1	G	T	17: 31,105,530	A250S	probably benign	Het
Acsf3	C	T	8: 122,813,634	H524Y	possibly damaging	Het
Agbl4	A	G	4: 110,660,842	K110R	unknown	Het
Arfgap2	G	A	2: 91,266,299		probably null	Het
B4galt4	T	C	16: 38,766,021		probably null	Het
Bex6	G	T	16: 32,186,406	D11Y	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
C8b	A	T	4: 104,790,614	D334V	probably damaging	Het
Capn11	T	C	17: 45,643,755	Q152R	probably null	Het
Ccdc171	C	A	4: 83,580,766	Q234K	probably damaging	Het
Clec2h	A	G	6: 128,674,003	D82G	probably benign	Het
Creld2	A	G	15: 88,826,429	D349G	probably damaging	Het
D430041D05Rik	A	G	2: 104,148,783	*1415Q	probably null	Het
D430042O09Rik	A	G	7: 125,843,016	E725G	probably benign	Het
Dnmt3a	T	C	12: 3,902,768	V755A	possibly damaging	Het
Doc2a	G	T	7: 126,850,992	V201L	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbn1	G	T	2: 125,351,969	D1359E	possibly damaging	Het
Fcnb	T	C	2: 28,079,695	Y120C	probably damaging	Het
Fras1	T	A	5: 96,694,919	D1665E	probably benign	Het
Fry	A	T	5: 150,495,767	D524V		Het
Garem1	A	G	18: 21,148,564	L245P	probably damaging	Het
Gdf6	A	G	4: 9,859,712	S265G	probably benign	Het
Gm5591	T	C	7: 38,518,939	I837V	probably benign	Het
Gpr61	T	C	3: 108,150,895	Y150C	probably damaging	Het
Grin2b	A	T	6: 135,733,227	L1107Q	probably damaging	Het
Helb	A	G	10: 120,105,578	S402P	probably benign	Het
Htt	A	G	5: 34,820,100	T777A	probably benign	Het
Iffo2	A	G	4: 139,613,853	D383G	probably benign	Het
Ikzf3	G	T	11: 98,516,927	Y29*	probably null	Het
Jmjd1c	T	C	10: 67,254,495	V2292A	not run	Het
Lamb1	C	A	12: 31,303,047	Q916K	probably benign	Het
Lrrtm4	G	A	6: 80,022,545	M313I	probably benign	Het
Lum	A	G	10: 97,568,563	I107V	probably benign	Het
Ly6h	T	C	15: 75,565,212	E126G	probably benign	Het
Map3k5	G	A	10: 20,132,114	V1230M	probably damaging	Het
Mcoln1	T	C	8: 3,508,378	F211L	probably benign	Het
Mink1	G	A	11: 70,603,768	W258*	probably null	Het
Muc16	G	T	9: 18,660,002	S407*	probably null	Het
Ngef	G	A	1: 87,546,022	Q13*	probably null	Het
Nxpe5	T	A	5: 138,239,311	Y44*	probably null	Het
Olfr1094	A	G	2: 86,829,708	R319G	probably benign	Het
Olfr1098	C	A	2: 86,922,807	A242S	probably benign	Het
Olfr1250	A	G	2: 89,657,327	V38A	probably benign	Het
Olfr18	T	A	9: 20,314,180	I247F	probably damaging	Het
Olfr270	T	A	4: 52,971,106	L162M	probably benign	Het
Olfr938	A	T	9: 39,078,566	Y60N	probably damaging	Het
Orc3	C	A	4: 34,595,223	E249*	probably null	Het
Otogl	A	T	10: 107,762,426	C2288S	probably damaging	Het
Pde1b	A	G	15: 103,524,811	E249G	probably damaging	Het
Phf2	T	C	13: 48,823,082	E219G	unknown	Het
Rbm19	T	A	5: 120,140,375		probably null	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Het
Sbk2	A	G	7: 4,957,290	Y294H	possibly damaging	Het
Selenoo	T	C	15: 89,092,739	I198T	possibly damaging	Het
Sema3f	T	C	9: 107,682,601	E729G	probably benign	Het
Serpinb1b	A	T	13: 33,085,310	T9S	probably benign	Het
Sfxn4	T	C	19: 60,844,252	T235A	probably damaging	Het
Shc4	A	T	2: 125,649,234	Y461*	probably null	Het
Slc22a15	T	C	3: 101,864,610	D391G	probably benign	Het
Slc22a23	G	T	13: 34,305,184	Y239*	probably null	Het
Slc24a2	G	A	4: 86,991,513	A656V	probably damaging	Het
Slc2a5	A	T	4: 150,143,133	I470F	probably damaging	Het
Sptbn4	T	C	7: 27,364,269	E2249G	possibly damaging	Het
Tas2r139	A	T	6: 42,141,819	Q295L	probably benign	Het
Tdrd7	C	A	4: 46,034,309	S1051R	probably benign	Het
Tmem2	C	A	19: 21,852,331	A1268E	probably benign	Het
Tnfrsf18	G	A	4: 156,028,345	A163T	probably benign	Het
Ube3b	T	C	5: 114,406,785	V596A	possibly damaging	Het
Vmn2r10	T	A	5: 109,002,089	N363I	probably benign	Het
Vmn2r15	T	A	5: 109,293,090	I301F	probably damaging	Het
Yod1	C	T	1: 130,719,069	Q228*	probably null	Het
Zfp433	A	T	10: 81,720,290	K209*	probably null	Het
Zfp865	G	A	7: 5,030,446	V477I	probably benign	Het
Zfp937	T	A	2: 150,239,501	Y484N	probably benign	Het
Zfp951	T	G	5: 104,814,446	H418P	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAACATGTAACCTGCCTGCC -3'
(R):5'- GCCTTGCCAGTGTCTTAATG -3'

Sequencing Primer
(F):5'- GTAAGTACACTGTAGCTGTCCTCAG -3'
(R):5'- GCCAGTGTCTTAATGTGTTTCCCATG -3'

Posted On

2020-01-23