Incidental Mutation 'R8058:Ints2'
ID 619558
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 067495-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8058 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86146179 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 143 (M143K)
Ref Sequence ENSEMBL: ENSMUSP00000018212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000132024] [ENSMUST00000136469] [ENSMUST00000139285]
AlphaFold Q80UK8
Predicted Effect probably benign
Transcript: ENSMUST00000018212
AA Change: M143K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: M143K

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108039
AA Change: M143K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: M143K

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132024
SMART Domains Protein: ENSMUSP00000114859
Gene: ENSMUSG00000018068

DomainStartEndE-ValueType
Pfam:INTS2 24 140 1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136469
SMART Domains Protein: ENSMUSP00000116633
Gene: ENSMUSG00000018068

DomainStartEndE-ValueType
Pfam:INTS2 24 98 6.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139285
AA Change: M143K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068
AA Change: M143K

DomainStartEndE-ValueType
Pfam:INTS2 24 190 1.4e-69 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,081,954 (GRCm39) D769N possibly damaging Het
Abcb6 A G 1: 75,156,653 (GRCm39) L37P possibly damaging Het
Abcg1 G T 17: 31,324,504 (GRCm39) A250S probably benign Het
Acsf3 C T 8: 123,540,373 (GRCm39) H524Y possibly damaging Het
Agbl4 A G 4: 110,518,039 (GRCm39) K110R unknown Het
Arfgap2 G A 2: 91,096,644 (GRCm39) probably null Het
B4galt4 T C 16: 38,586,383 (GRCm39) probably null Het
Bex6 G T 16: 32,005,224 (GRCm39) D11Y probably damaging Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
C8b A T 4: 104,647,811 (GRCm39) D334V probably damaging Het
Capn11 T C 17: 45,954,681 (GRCm39) Q152R probably null Het
Ccdc171 C A 4: 83,499,003 (GRCm39) Q234K probably damaging Het
Cemip2 C A 19: 21,829,695 (GRCm39) A1268E probably benign Het
Clec2h A G 6: 128,650,966 (GRCm39) D82G probably benign Het
Creld2 A G 15: 88,710,632 (GRCm39) D349G probably damaging Het
D430041D05Rik A G 2: 103,979,128 (GRCm39) *1415Q probably null Het
Dnmt3a T C 12: 3,952,768 (GRCm39) V755A possibly damaging Het
Doc2a G T 7: 126,450,164 (GRCm39) V201L probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fbn1 G T 2: 125,193,889 (GRCm39) D1359E possibly damaging Het
Fcnb T C 2: 27,969,707 (GRCm39) Y120C probably damaging Het
Fras1 T A 5: 96,842,778 (GRCm39) D1665E probably benign Het
Fry A T 5: 150,419,232 (GRCm39) D524V Het
Garem1 A G 18: 21,281,621 (GRCm39) L245P probably damaging Het
Gdf6 A G 4: 9,859,712 (GRCm39) S265G probably benign Het
Gm5591 T C 7: 38,218,363 (GRCm39) I837V probably benign Het
Gpr61 T C 3: 108,058,211 (GRCm39) Y150C probably damaging Het
Grin2b A T 6: 135,710,225 (GRCm39) L1107Q probably damaging Het
Helb A G 10: 119,941,483 (GRCm39) S402P probably benign Het
Htt A G 5: 34,977,444 (GRCm39) T777A probably benign Het
Iffo2 A G 4: 139,341,164 (GRCm39) D383G probably benign Het
Ikzf3 G T 11: 98,407,753 (GRCm39) Y29* probably null Het
Jmjd1c T C 10: 67,090,274 (GRCm39) V2292A not run Het
Katnip A G 7: 125,442,188 (GRCm39) E725G probably benign Het
Lamb1 C A 12: 31,353,046 (GRCm39) Q916K probably benign Het
Lrrtm4 G A 6: 79,999,528 (GRCm39) M313I probably benign Het
Lum A G 10: 97,404,425 (GRCm39) I107V probably benign Het
Ly6h T C 15: 75,437,061 (GRCm39) E126G probably benign Het
Map3k5 G A 10: 20,007,860 (GRCm39) V1230M probably damaging Het
Mcoln1 T C 8: 3,558,378 (GRCm39) F211L probably benign Het
Mink1 G A 11: 70,494,594 (GRCm39) W258* probably null Het
Muc16 G T 9: 18,571,298 (GRCm39) S407* probably null Het
Ngef G A 1: 87,473,744 (GRCm39) Q13* probably null Het
Nxpe5 T A 5: 138,237,573 (GRCm39) Y44* probably null Het
Or13d1 T A 4: 52,971,106 (GRCm39) L162M probably benign Het
Or4a77 A G 2: 89,487,671 (GRCm39) V38A probably benign Het
Or5t9 A G 2: 86,660,052 (GRCm39) R319G probably benign Het
Or7e178 T A 9: 20,225,476 (GRCm39) I247F probably damaging Het
Or8g24 A T 9: 38,989,862 (GRCm39) Y60N probably damaging Het
Or8h8 C A 2: 86,753,151 (GRCm39) A242S probably benign Het
Orc3 C A 4: 34,595,223 (GRCm39) E249* probably null Het
Otogl A T 10: 107,598,287 (GRCm39) C2288S probably damaging Het
Pde1b A G 15: 103,433,238 (GRCm39) E249G probably damaging Het
Phf2 T C 13: 48,976,558 (GRCm39) E219G unknown Het
Rbm19 T A 5: 120,278,440 (GRCm39) probably null Het
Rcc2 G A 4: 140,429,586 (GRCm39) C40Y probably benign Het
Sbk2 A G 7: 4,960,289 (GRCm39) Y294H possibly damaging Het
Selenoo T C 15: 88,976,942 (GRCm39) I198T possibly damaging Het
Sema3f T C 9: 107,559,800 (GRCm39) E729G probably benign Het
Serpinb1b A T 13: 33,269,293 (GRCm39) T9S probably benign Het
Sfxn4 T C 19: 60,832,690 (GRCm39) T235A probably damaging Het
Shc4 A T 2: 125,491,154 (GRCm39) Y461* probably null Het
Slc22a15 T C 3: 101,771,926 (GRCm39) D391G probably benign Het
Slc22a23 G T 13: 34,489,167 (GRCm39) Y239* probably null Het
Slc24a2 G A 4: 86,909,750 (GRCm39) A656V probably damaging Het
Slc2a5 A T 4: 150,227,590 (GRCm39) I470F probably damaging Het
Sptbn4 T C 7: 27,063,694 (GRCm39) E2249G possibly damaging Het
Tas2r139 A T 6: 42,118,753 (GRCm39) Q295L probably benign Het
Tdrd7 C A 4: 46,034,309 (GRCm39) S1051R probably benign Het
Tnfrsf18 G A 4: 156,112,802 (GRCm39) A163T probably benign Het
Ube3b T C 5: 114,544,846 (GRCm39) V596A possibly damaging Het
Vmn2r10 T A 5: 109,149,955 (GRCm39) N363I probably benign Het
Vmn2r15 T A 5: 109,440,956 (GRCm39) I301F probably damaging Het
Yod1 C T 1: 130,646,806 (GRCm39) Q228* probably null Het
Zfp433 A T 10: 81,556,124 (GRCm39) K209* probably null Het
Zfp865 G A 7: 5,033,445 (GRCm39) V477I probably benign Het
Zfp937 T A 2: 150,081,421 (GRCm39) Y484N probably benign Het
Zfp951 T G 5: 104,962,312 (GRCm39) H418P probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,140,074 (GRCm39) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,113,000 (GRCm39) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,117,574 (GRCm39) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6209:Ints2 UTSW 11 86,115,884 (GRCm39) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,106,444 (GRCm39) missense probably damaging 1.00
R7503:Ints2 UTSW 11 86,122,881 (GRCm39) missense probably benign
R7804:Ints2 UTSW 11 86,103,489 (GRCm39) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,103,888 (GRCm39) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,103,720 (GRCm39) missense probably benign 0.00
R9037:Ints2 UTSW 11 86,106,530 (GRCm39) missense probably benign
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GAACATGTAACCTGCCTGCC -3'
(R):5'- GCCTTGCCAGTGTCTTAATG -3'

Sequencing Primer
(F):5'- GTAAGTACACTGTAGCTGTCCTCAG -3'
(R):5'- GCCAGTGTCTTAATGTGTTTCCCATG -3'
Posted On 2020-01-23