Incidental Mutation 'R8059:Pax3'
ID619577
Institutional Source Beutler Lab
Gene Symbol Pax3
Ensembl Gene ENSMUSG00000004872
Gene Namepaired box 3
SynonymsPax-3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location78101267-78197134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78103366 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 461 (D461G)
Ref Sequence ENSEMBL: ENSMUSP00000004994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004994] [ENSMUST00000087086]
Predicted Effect probably benign
Transcript: ENSMUST00000004994
AA Change: D461G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000004994
Gene: ENSMUSG00000004872
AA Change: D461G

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 347 391 5.9e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000087086
AA Change: D461G

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000084320
Gene: ENSMUSG00000004872
AA Change: D461G

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 346 391 5.3e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
PHENOTYPE: Effects on homozygotes for mutations in this gene vary in severity and include embryonic to perinatal death, malformations of neural tube, spinal ganglia, heart, vertebral column, hindbrain and limb musculature. Heterozygotes have white belly spots and variable spotting on the back and extremeties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Pax3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pax3 APN 1 78196663 critical splice donor site probably null
IGL02249:Pax3 APN 1 78195325 missense probably damaging 0.98
IGL02271:Pax3 APN 1 78195332 missense probably damaging 1.00
IGL02376:Pax3 APN 1 78132292 missense probably damaging 1.00
IGL02530:Pax3 APN 1 78121787 missense possibly damaging 0.87
IGL02950:Pax3 APN 1 78103360 missense probably benign 0.06
Nidoqueen UTSW 1 78132232 missense probably damaging 1.00
Widget UTSW 1 78122590 critical splice donor site probably null
R0049:Pax3 UTSW 1 78103504 missense probably damaging 1.00
R0049:Pax3 UTSW 1 78103504 missense probably damaging 1.00
R0523:Pax3 UTSW 1 78195441 missense possibly damaging 0.83
R1575:Pax3 UTSW 1 78103484 missense probably benign 0.00
R1831:Pax3 UTSW 1 78132340 missense probably damaging 1.00
R1934:Pax3 UTSW 1 78103480 missense possibly damaging 0.90
R2420:Pax3 UTSW 1 78196864 splice site probably null
R2473:Pax3 UTSW 1 78122590 critical splice donor site probably null
R4430:Pax3 UTSW 1 78195324 missense probably damaging 1.00
R4693:Pax3 UTSW 1 78196746 missense probably benign 0.00
R4818:Pax3 UTSW 1 78132232 missense probably damaging 1.00
R4860:Pax3 UTSW 1 78192456 missense possibly damaging 0.78
R4860:Pax3 UTSW 1 78192456 missense possibly damaging 0.78
R5302:Pax3 UTSW 1 78121612 missense possibly damaging 0.88
R5475:Pax3 UTSW 1 78103418 missense probably benign 0.06
R5855:Pax3 UTSW 1 78121651 missense probably damaging 0.99
R6102:Pax3 UTSW 1 78132347 missense probably damaging 1.00
R6190:Pax3 UTSW 1 78192549 missense possibly damaging 0.63
R6856:Pax3 UTSW 1 78132419 missense probably damaging 1.00
R7065:Pax3 UTSW 1 78194011 splice site probably null
R7547:Pax3 UTSW 1 78122594 nonsense probably null
R8224:Pax3 UTSW 1 78121690 missense probably damaging 1.00
R8312:Pax3 UTSW 1 78195369 missense probably damaging 1.00
R8324:Pax3 UTSW 1 78193789 missense probably damaging 1.00
Z1176:Pax3 UTSW 1 78122590 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTACACAAGGGAGCCTGTGC -3'
(R):5'- AATGGGACTTCTGACCAACC -3'

Sequencing Primer
(F):5'- GCAAGAGGTGATCTCTCT -3'
(R):5'- TTCTGACCAACCACGGTG -3'
Posted On2020-01-23