Incidental Mutation 'R8059:Maml3'
ID619582
Institutional Source Beutler Lab
Gene Symbol Maml3
Ensembl Gene ENSMUSG00000061143
Gene Namemastermind like transcriptional coactivator 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8059 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location51685907-52105076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51856689 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 285 (S285P)
Ref Sequence ENSEMBL: ENSMUSP00000112637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121440]
Predicted Effect probably damaging
Transcript: ENSMUST00000121440
AA Change: S285P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112637
Gene: ENSMUSG00000061143
AA Change: S285P

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 12 32 N/A INTRINSIC
low complexity region 44 65 N/A INTRINSIC
MamL-1 67 126 6.54e-30 SMART
low complexity region 436 454 N/A INTRINSIC
coiled coil region 459 502 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 621 647 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
coiled coil region 736 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Maml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Maml3 APN 3 51690704 missense probably benign 0.13
IGL01138:Maml3 APN 3 51690558 missense possibly damaging 0.87
IGL02173:Maml3 APN 3 51690787 missense probably damaging 0.96
IGL02220:Maml3 APN 3 51690218 missense possibly damaging 0.94
IGL02725:Maml3 APN 3 52103774 missense probably damaging 0.97
IGL02838:Maml3 APN 3 51690090 missense probably damaging 1.00
R0683:Maml3 UTSW 3 51856752 nonsense probably null
R1966:Maml3 UTSW 3 52104139 missense unknown
R1980:Maml3 UTSW 3 52104052 missense unknown
R1989:Maml3 UTSW 3 51697758 missense probably damaging 0.98
R1992:Maml3 UTSW 3 51690757 missense probably benign 0.01
R2047:Maml3 UTSW 3 51690445 missense probably damaging 1.00
R2113:Maml3 UTSW 3 51690656 missense probably damaging 1.00
R2876:Maml3 UTSW 3 51690059 missense possibly damaging 0.86
R3176:Maml3 UTSW 3 51856930 missense possibly damaging 0.62
R3276:Maml3 UTSW 3 51856930 missense possibly damaging 0.62
R4191:Maml3 UTSW 3 51689969 missense probably benign
R4576:Maml3 UTSW 3 51856506 nonsense probably null
R4609:Maml3 UTSW 3 51855592 missense probably damaging 1.00
R4628:Maml3 UTSW 3 51796470 intron probably benign
R4734:Maml3 UTSW 3 51689875 missense probably damaging 1.00
R4776:Maml3 UTSW 3 51856532 missense probably benign 0.28
R4868:Maml3 UTSW 3 52103924 nonsense probably null
R4889:Maml3 UTSW 3 51694510 intron probably benign
R4891:Maml3 UTSW 3 51694510 intron probably benign
R4947:Maml3 UTSW 3 51856539 missense probably benign 0.01
R5011:Maml3 UTSW 3 51690775 missense possibly damaging 0.87
R5047:Maml3 UTSW 3 51690841 missense possibly damaging 0.88
R5344:Maml3 UTSW 3 52103725 missense probably damaging 0.99
R5743:Maml3 UTSW 3 52104132 missense unknown
R6724:Maml3 UTSW 3 51855875 missense probably damaging 1.00
R6885:Maml3 UTSW 3 51697579
R6938:Maml3 UTSW 3 52103738 missense probably damaging 0.98
R7581:Maml3 UTSW 3 51856768 missense probably benign 0.06
R7895:Maml3 UTSW 3 51697722 missense probably damaging 1.00
R7978:Maml3 UTSW 3 51697722 missense probably damaging 1.00
RF022:Maml3 UTSW 3 51856662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATCGCTCTTCACACTC -3'
(R):5'- TGGAAGCCATCAACAATTTGCC -3'

Sequencing Primer
(F):5'- ACTCACGCTCTCCTGGGAG -3'
(R):5'- ATGCCCCTGACGTCAGCATC -3'
Posted On2020-01-23