Incidental Mutation 'R8059:Tmem57'
ID619587
Institutional Source Beutler Lab
Gene Symbol Tmem57
Ensembl Gene ENSMUSG00000028826
Gene Nametransmembrane protein 57
Synonyms1110007C24Rik, C61, 9230118A01Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location134802759-134853345 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 134828048 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 371 (C371*)
Ref Sequence ENSEMBL: ENSMUSP00000030628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030628] [ENSMUST00000137707] [ENSMUST00000148595]
Predicted Effect probably null
Transcript: ENSMUST00000030628
AA Change: C371*
SMART Domains Protein: ENSMUSP00000030628
Gene: ENSMUSG00000028826
AA Change: C371*

DomainStartEndE-ValueType
Pfam:Macoilin 2 662 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137707
SMART Domains Protein: ENSMUSP00000124477
Gene: ENSMUSG00000028826

DomainStartEndE-ValueType
Pfam:Macoilin 2 157 2.1e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148595
SMART Domains Protein: ENSMUSP00000125440
Gene: ENSMUSG00000028826

DomainStartEndE-ValueType
Pfam:Macoilin 2 78 7e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Tmem57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Tmem57 APN 4 134828206 missense probably damaging 0.96
IGL01062:Tmem57 APN 4 134833297 missense probably damaging 0.97
IGL02249:Tmem57 APN 4 134828312 missense possibly damaging 0.50
IGL02850:Tmem57 APN 4 134828386 missense probably benign 0.12
subtle UTSW 4 134828299 missense probably damaging 1.00
R0400:Tmem57 UTSW 4 134828116 missense probably benign 0.25
R0548:Tmem57 UTSW 4 134806660 missense probably damaging 1.00
R0589:Tmem57 UTSW 4 134828217 missense probably benign 0.30
R1536:Tmem57 UTSW 4 134804507 missense probably damaging 1.00
R2063:Tmem57 UTSW 4 134828279 missense possibly damaging 0.95
R2151:Tmem57 UTSW 4 134811223 missense probably benign 0.00
R2509:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R2510:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R2511:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R3806:Tmem57 UTSW 4 134830580 missense probably benign 0.00
R3946:Tmem57 UTSW 4 134804481 missense probably damaging 1.00
R4994:Tmem57 UTSW 4 134828299 missense probably damaging 1.00
R4999:Tmem57 UTSW 4 134828133 missense probably benign 0.23
R5169:Tmem57 UTSW 4 134828463 missense probably benign 0.23
R5310:Tmem57 UTSW 4 134837019 intron probably benign
R5443:Tmem57 UTSW 4 134833308 nonsense probably null
R5554:Tmem57 UTSW 4 134828134 missense probably benign
R5712:Tmem57 UTSW 4 134828058 missense probably benign 0.06
R6627:Tmem57 UTSW 4 134836343 missense probably damaging 0.98
R7100:Tmem57 UTSW 4 134806660 missense probably damaging 1.00
R7448:Tmem57 UTSW 4 134828279 missense possibly damaging 0.95
R8300:Tmem57 UTSW 4 134828451 missense probably benign
X0062:Tmem57 UTSW 4 134836347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCCTACACAGGTGCCTAC -3'
(R):5'- ACAATGATCTTGTGGGAAGTACAG -3'

Sequencing Primer
(F):5'- GGTGCCTACAAACCCGTGTAAAG -3'
(R):5'- AAGAGGACTCATGCACTGCTTC -3'
Posted On2020-01-23