Incidental Mutation 'R8059:Mapk10'
ID619590
Institutional Source Beutler Lab
Gene Symbol Mapk10
Ensembl Gene ENSMUSG00000046709
Gene Namemitogen-activated protein kinase 10
Synonymsp493F12, JNK3, Serk2, C230008H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location102907948-103211334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102966612 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 303 (N303K)
Ref Sequence ENSEMBL: ENSMUSP00000108469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086854] [ENSMUST00000112846] [ENSMUST00000112847] [ENSMUST00000112848] [ENSMUST00000141573] [ENSMUST00000170792]
Predicted Effect probably damaging
Transcript: ENSMUST00000086854
AA Change: N273K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084065
Gene: ENSMUSG00000046709
AA Change: N273K

DomainStartEndE-ValueType
S_TKc 64 359 5.76e-88 SMART
low complexity region 423 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112846
AA Change: N273K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108467
Gene: ENSMUSG00000046709
AA Change: N273K

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112847
AA Change: N273K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108468
Gene: ENSMUSG00000046709
AA Change: N273K

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
low complexity region 423 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112848
AA Change: N303K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108469
Gene: ENSMUSG00000046709
AA Change: N303K

DomainStartEndE-ValueType
S_TKc 94 389 4.37e-88 SMART
low complexity region 453 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141573
SMART Domains Protein: ENSMUSP00000142798
Gene: ENSMUSG00000046709

DomainStartEndE-ValueType
Pfam:Pkinase 64 125 1.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170792
AA Change: N273K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127193
Gene: ENSMUSG00000046709
AA Change: N273K

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as integration points for multiple biochemical signals and are involved in a wide variety of cellular processes, such as proliferation, differentiation, transcription regulation and development. This kinase is specifically expressed in a subset of neurons in the nervous system and is activated by threonine and tyrosine phosphorylation. Targeted deletion of this gene in mice suggests that it may have a role in stress-induced neuronal apoptosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. They are resistant to kainic acid induced seizures and show increased resistance to MPTP induced Parkinson's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Mapk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Mapk10 APN 5 102926152 splice site probably benign
IGL01791:Mapk10 APN 5 102996648 missense probably damaging 1.00
IGL01885:Mapk10 APN 5 102996589 missense probably damaging 1.00
IGL02192:Mapk10 APN 5 102989647 missense probably damaging 0.97
IGL02260:Mapk10 APN 5 103038668 missense probably benign 0.09
IGL02409:Mapk10 APN 5 102928230 missense possibly damaging 0.50
IGL03148:Mapk10 APN 5 102926105 missense probably damaging 1.00
R0904:Mapk10 UTSW 5 102987280 splice site probably benign
R1067:Mapk10 UTSW 5 102991857 splice site probably benign
R1592:Mapk10 UTSW 5 103038621 missense possibly damaging 0.89
R1812:Mapk10 UTSW 5 102913262 missense probably damaging 1.00
R2364:Mapk10 UTSW 5 103038641 missense possibly damaging 0.81
R2866:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R2867:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R2867:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R4622:Mapk10 UTSW 5 102989724 missense probably damaging 1.00
R4860:Mapk10 UTSW 5 102990619 missense probably damaging 1.00
R4860:Mapk10 UTSW 5 102990619 missense probably damaging 1.00
R4866:Mapk10 UTSW 5 102963525 missense probably damaging 1.00
R5901:Mapk10 UTSW 5 102913292 missense probably damaging 1.00
R5986:Mapk10 UTSW 5 103038580 missense probably benign 0.33
R6000:Mapk10 UTSW 5 102966475 missense probably damaging 1.00
R6000:Mapk10 UTSW 5 102966476 missense probably damaging 1.00
R7375:Mapk10 UTSW 5 102976390 missense probably null 0.26
R7460:Mapk10 UTSW 5 103038577 missense probably benign 0.37
R7753:Mapk10 UTSW 5 103038553 nonsense probably null
R7879:Mapk10 UTSW 5 102963496 missense probably benign 0.10
R7935:Mapk10 UTSW 5 102991926 missense possibly damaging 0.92
R8846:Mapk10 UTSW 5 102996655 missense probably damaging 1.00
Z1176:Mapk10 UTSW 5 102991887 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAATGCAAGCCCAGGCAAG -3'
(R):5'- GTCTAAAATTCCAAGAGGACTCCCAG -3'

Sequencing Primer
(F):5'- TCCCAGAATGTGACCATCTGG -3'
(R):5'- GACTCCCAGGCTGTGAACTTTG -3'
Posted On2020-01-23