Mutagenetix > Incidental Mutations

Incidental Mutation 'R8059:Chl1'

619594

Institutional Source

Beutler Lab

Gene Symbol

Chl1

Ensembl Gene

ENSMUSG00000030077

Gene Name

cell adhesion molecule L1-like

Synonyms

A530023M13Rik, LICAM2, close homolog of L1, CALL

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.412) question?

Stock #

R8059 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103510586-103750211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103674987 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 272 (I272N)

Ref Sequence

ENSEMBL: ENSMUSP00000063933 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912]

Predicted Effect

probably damaging
Transcript: ENSMUST00000066905
AA Change: I272N

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: I272N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203830
AA Change: I272N

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: I272N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203912
AA Change: I288N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: I288N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	269	333	3.76e-17	SMART
IGc2	359	424	1.61e-7	SMART
IGc2	452	517	1.56e-5	SMART
IG	537	625	6.02e-7	SMART
IG_like	555	614	1.27e-1	SMART
FN3	628	711	2.24e-13	SMART
FN3	728	810	1.92e-3	SMART
FN3	826	917	2.3e-1	SMART
FN3	932	1018	4.09e-7	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1067	1131	2.5e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,279	M3372K	probably benign	Het
Abcg3	A	T	5: 104,953,082		probably null	Het
Adgrg6	G	T	10: 14,469,050	T53K	probably damaging	Het
Ccdc141	A	C	2: 77,044,751	L705R	probably damaging	Het
Cep78	A	T	19: 15,981,512	V156E	probably benign	Het
Cers2	A	G	3: 95,322,671	D342G	probably damaging	Het
Defb30	A	G	14: 63,035,934	*77Q	probably null	Het
Dnm3	A	G	1: 162,084,139	V63A	probably damaging	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Entpd2	G	T	2: 25,398,084	V107L	probably damaging	Het
Hectd1	T	A	12: 51,790,378	H799L	possibly damaging	Het
Hira	T	C	16: 18,912,151	V200A	probably damaging	Het
Hspd1	T	C	1: 55,081,724	K269E	possibly damaging	Het
Kcnj4	T	C	15: 79,484,802	S326G	probably benign	Het
Kctd19	T	G	8: 105,396,351	I144L	probably benign	Het
Lama4	T	C	10: 38,966,061	I36T	probably benign	Het
Lrrn3	T	C	12: 41,454,217	T34A	probably benign	Het
Maml3	A	G	3: 51,856,689	S285P	probably damaging	Het
Man2b2	A	G	5: 36,816,160	Y492H	probably damaging	Het
Mapk10	G	T	5: 102,966,612	N303K	probably damaging	Het
Matn2	C	T	15: 34,345,335	R163C	probably damaging	Het
Mtmr7	C	T	8: 40,581,522	A253T	probably damaging	Het
Naca	C	T	10: 128,040,503	P468L	unknown	Het
Nckap1l	T	C	15: 103,493,287	S1084P	possibly damaging	Het
Nek11	T	C	9: 105,162,974	*629W	probably null	Het
Nfkb1	C	T	3: 135,593,852	A731T	possibly damaging	Het
Nop2	T	C	6: 125,140,812	V442A	probably damaging	Het
Oaz2	C	T	9: 65,689,143	P163L	probably damaging	Het
Olfr1056	A	G	2: 86,355,962	V140A	probably benign	Het
Olfr214	C	T	6: 116,556,473	T16I	possibly damaging	Het
Olfr480	T	C	7: 108,066,016	T231A	probably benign	Het
Pabpc2	A	T	18: 39,774,822	N380I	probably benign	Het
Pax3	T	C	1: 78,103,366	D461G	probably benign	Het
Pds5b	G	T	5: 150,807,835	R1443L	unknown	Het
Per1	G	A	11: 69,106,483	R828H	probably damaging	Het
Phlpp2	T	A	8: 109,895,557	S144T	probably benign	Het
Plod1	A	T	4: 147,928,484	I207N	probably damaging	Het
Psmc6	A	T	14: 45,340,803	I208F	probably damaging	Het
Rev3l	T	C	10: 39,843,495	S2494P	probably damaging	Het
Slc17a6	T	A	7: 51,645,044	N166K	probably damaging	Het
Slc18a2	A	T	19: 59,284,140	T348S	probably benign	Het
Slc39a8	G	T	3: 135,826,586	A39S	probably benign	Het
Slc8a3	C	T	12: 81,202,258	G799S	probably damaging	Het
Sp1	T	G	15: 102,407,902	S46R	possibly damaging	Het
Stab1	G	A	14: 31,160,241	P499L	probably benign	Het
Tmem57	A	T	4: 134,828,048	C371*	probably null	Het
Trav21-dv12	C	A	14: 53,876,721	D99E	probably damaging	Het
Trpv6	T	G	6: 41,624,586	I467L	probably benign	Het
Ttc41	A	G	10: 86,712,978	Y12C	probably benign	Het
Vmn1r233	T	C	17: 20,994,436	N84S	probably benign	Het
Vrtn	T	C	12: 84,649,916	F480S	probably benign	Het
Wdr63	C	G	3: 146,046,673	R749S	possibly damaging	Het
Zc3h13	C	G	14: 75,327,810	R788G	unknown	Het

Other mutations in Chl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Chl1	APN	6	103693061	missense	probably benign	0.08
IGL00786:Chl1	APN	6	103675145	missense	probably damaging	1.00
IGL00959:Chl1	APN	6	103709250	splice site	probably null
IGL01109:Chl1	APN	6	103715393	missense	probably damaging	1.00
IGL01354:Chl1	APN	6	103665853	missense	probably benign	0.01
IGL01367:Chl1	APN	6	103729225	missense	probably benign	0.42
IGL01371:Chl1	APN	6	103715364	missense	probably damaging	1.00
IGL01599:Chl1	APN	6	103708484	missense	probably benign	0.34
IGL01724:Chl1	APN	6	103649573	missense	probably damaging	1.00
IGL02001:Chl1	APN	6	103642056	missense	possibly damaging	0.90
IGL02066:Chl1	APN	6	103698224	missense	probably benign	0.39
IGL02122:Chl1	APN	6	103675137	missense	probably benign	0.39
IGL02340:Chl1	APN	6	103698125	missense	probably damaging	1.00
IGL02420:Chl1	APN	6	103715369	missense	probably damaging	1.00
IGL02421:Chl1	APN	6	103717580	missense	probably damaging	1.00
IGL02429:Chl1	APN	6	103664809	unclassified	probably benign
IGL02825:Chl1	APN	6	103668803	missense	possibly damaging	0.87
IGL02858:Chl1	APN	6	103641988	missense	probably damaging	1.00
IGL03169:Chl1	APN	6	103665967	missense	probably damaging	1.00
IGL03185:Chl1	APN	6	103665863	missense	probably damaging	1.00
IGL03189:Chl1	APN	6	103683207	missense	possibly damaging	0.91
IGL03288:Chl1	APN	6	103675097	missense	probably damaging	1.00
IGL03404:Chl1	APN	6	103693091	missense	probably damaging	1.00
IGL03052:Chl1	UTSW	6	103691667	missense	probably benign	0.01
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0062:Chl1	UTSW	6	103749652	missense	unknown
R0314:Chl1	UTSW	6	103647301	missense	probably damaging	1.00
R0322:Chl1	UTSW	6	103701883	splice site	probably benign
R0685:Chl1	UTSW	6	103708542	splice site	probably null
R0702:Chl1	UTSW	6	103706622	missense	probably damaging	1.00
R1056:Chl1	UTSW	6	103675077	missense	possibly damaging	0.66
R1138:Chl1	UTSW	6	103693179	missense	probably benign	0.05
R1483:Chl1	UTSW	6	103647287	missense	probably damaging	1.00
R1571:Chl1	UTSW	6	103708484	missense	probably benign	0.34
R1620:Chl1	UTSW	6	103690242	missense	probably benign	0.00
R1645:Chl1	UTSW	6	103683180	missense	probably benign	0.06
R1773:Chl1	UTSW	6	103647331	critical splice donor site	probably null
R1852:Chl1	UTSW	6	103699159	splice site	probably null
R1891:Chl1	UTSW	6	103714583	missense	possibly damaging	0.88
R2146:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2147:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2148:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2163:Chl1	UTSW	6	103711231	missense	probably damaging	1.00
R2291:Chl1	UTSW	6	103715393	missense	probably damaging	1.00
R2920:Chl1	UTSW	6	103695343	missense	probably damaging	1.00
R3611:Chl1	UTSW	6	103698155	missense	probably damaging	1.00
R3979:Chl1	UTSW	6	103715284	nonsense	probably null
R4987:Chl1	UTSW	6	103674977	missense	probably damaging	1.00
R5266:Chl1	UTSW	6	103700543	missense	probably damaging	1.00
R5478:Chl1	UTSW	6	103683221	missense	probably damaging	1.00
R5523:Chl1	UTSW	6	103708714	missense	probably damaging	1.00
R5887:Chl1	UTSW	6	103717604	missense	probably benign	0.00
R5986:Chl1	UTSW	6	103709191	missense	probably benign	0.45
R6101:Chl1	UTSW	6	103693032	missense	probably damaging	0.96
R6179:Chl1	UTSW	6	103683243	missense	probably benign	0.38
R6366:Chl1	UTSW	6	103729236	missense	possibly damaging	0.95
R6634:Chl1	UTSW	6	103690259	missense	probably damaging	1.00
R6824:Chl1	UTSW	6	103714549	missense	probably damaging	1.00
R6913:Chl1	UTSW	6	103665948	nonsense	probably null
R7097:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7122:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7198:Chl1	UTSW	6	103706556	missense	probably damaging	1.00
R7203:Chl1	UTSW	6	103691674	missense	probably benign	0.13
R7527:Chl1	UTSW	6	103711201	missense	probably damaging	1.00
R7625:Chl1	UTSW	6	103729125	missense	probably damaging	1.00
R7667:Chl1	UTSW	6	103695495	missense	possibly damaging	0.82
R7683:Chl1	UTSW	6	103691652	missense	possibly damaging	0.72
R7712:Chl1	UTSW	6	103711102	missense	possibly damaging	0.94
R7838:Chl1	UTSW	6	103691674	missense	probably benign	0.01
R7863:Chl1	UTSW	6	103706514	missense	possibly damaging	0.46
R7874:Chl1	UTSW	6	103690263	missense	probably benign	0.22
R7998:Chl1	UTSW	6	103729289	missense	probably benign	0.01
R8044:Chl1	UTSW	6	103706632	missense	probably damaging	0.96
Z1177:Chl1	UTSW	6	103693096	nonsense	probably null
Z1177:Chl1	UTSW	6	103697949	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GTAGACTTAGCCTCCTTCCAGAAC -3'
(R):5'- CGTACCTTCTACTGTGACGTG -3'

Sequencing Primer
(F):5'- TTCCTAGGGAGTAGACCATTAAAAG -3'
(R):5'- GTGAAAATCATGACTGGCTTTCCC -3'

Posted On

2020-01-23