Incidental Mutation 'R8059:Olfr214'
ID619595
Institutional Source Beutler Lab
Gene Symbol Olfr214
Ensembl Gene ENSMUSG00000051046
Gene Nameolfactory receptor 214
SynonymsMOR119-1, GA_x54KRFPKN04-58190962-58191900
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R8059 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location116554235-116560611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116556473 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 16 (T16I)
Ref Sequence ENSEMBL: ENSMUSP00000145465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060204] [ENSMUST00000122096] [ENSMUST00000203867] [ENSMUST00000214699] [ENSMUST00000215846] [ENSMUST00000217313]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060204
AA Change: T16I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052730
Gene: ENSMUSG00000051046
AA Change: T16I

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.7e-47 PFAM
Pfam:7tm_1 49 298 5.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122096
SMART Domains Protein: ENSMUSP00000145194
Gene: ENSMUSG00000107906

DomainStartEndE-ValueType
DEXDc 57 254 2.4e-59 SMART
HELICc 291 372 6.6e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203867
AA Change: T16I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145465
Gene: ENSMUSG00000051046
AA Change: T16I

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.7e-47 PFAM
Pfam:7tm_1 49 298 5.9e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214699
AA Change: T16I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215846
AA Change: T16I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217313
AA Change: T16I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Olfr214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr214 APN 6 116557066 missense probably benign
IGL01837:Olfr214 APN 6 116556846 nonsense probably null
IGL02523:Olfr214 APN 6 116557093 missense probably benign 0.03
R0027:Olfr214 UTSW 6 116556949 missense probably damaging 0.99
R0616:Olfr214 UTSW 6 116556928 missense probably benign 0.00
R1121:Olfr214 UTSW 6 116557229 missense probably damaging 0.99
R1555:Olfr214 UTSW 6 116556826 missense probably damaging 1.00
R1691:Olfr214 UTSW 6 116556577 missense probably benign 0.00
R2196:Olfr214 UTSW 6 116556617 missense probably damaging 0.99
R3080:Olfr214 UTSW 6 116557217 missense probably damaging 0.98
R5416:Olfr214 UTSW 6 116557205 missense probably damaging 1.00
R5706:Olfr214 UTSW 6 116557113 missense probably damaging 1.00
R6848:Olfr214 UTSW 6 116556775 missense probably damaging 0.98
R7425:Olfr214 UTSW 6 116556437 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATTTGTATTTCAGAAATGAGAGAAGGG -3'
(R):5'- CTCCTGAGGAAGAAGTACATCG -3'

Sequencing Primer
(F):5'- CTCCTAGTGAGGCTGAACAAG -3'
(R):5'- AGTACATCGGGGTCTGCAG -3'
Posted On2020-01-23