Incidental Mutation 'R8059:Slc17a6'
ID619597
Institutional Source Beutler Lab
Gene Symbol Slc17a6
Ensembl Gene ENSMUSG00000030500
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms2900073D12Rik, VGLUT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location51622006-51671119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51645044 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 166 (N166K)
Ref Sequence ENSEMBL: ENSMUSP00000032710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032710] [ENSMUST00000207945]
Predicted Effect probably damaging
Transcript: ENSMUST00000032710
AA Change: N166K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032710
Gene: ENSMUSG00000030500
AA Change: N166K

DomainStartEndE-ValueType
Pfam:MFS_1 76 461 6.5e-50 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207945
AA Change: N166K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal lethality, respiratory failure, and abnormal nervous system physiology. Heterozygous mice for one allele display abnormal miniature EPSC and reduced responses to neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Slc17a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01408:Slc17a6 APN 7 51669115 missense probably benign 0.15
IGL01653:Slc17a6 APN 7 51668022 missense possibly damaging 0.92
IGL01993:Slc17a6 APN 7 51667957 missense possibly damaging 0.51
IGL02082:Slc17a6 APN 7 51669029 missense probably benign 0.00
IGL02212:Slc17a6 APN 7 51667470 missense possibly damaging 0.94
IGL02544:Slc17a6 APN 7 51666155 nonsense probably null
IGL02585:Slc17a6 APN 7 51625349 missense probably benign 0.00
IGL03206:Slc17a6 APN 7 51666023 splice site probably benign
IGL03396:Slc17a6 APN 7 51669092 missense probably damaging 1.00
R0137:Slc17a6 UTSW 7 51666144 missense probably benign 0.00
R0141:Slc17a6 UTSW 7 51669067 missense probably benign 0.10
R0207:Slc17a6 UTSW 7 51646180 intron probably benign
R0362:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R0841:Slc17a6 UTSW 7 51625315 missense probably benign 0.29
R1037:Slc17a6 UTSW 7 51649248 splice site probably benign
R1325:Slc17a6 UTSW 7 51661552 missense probably benign 0.15
R1614:Slc17a6 UTSW 7 51646277 intron probably benign
R1625:Slc17a6 UTSW 7 51661460 missense probably benign 0.00
R1736:Slc17a6 UTSW 7 51661585 splice site probably benign
R1777:Slc17a6 UTSW 7 51646209 missense possibly damaging 0.63
R1824:Slc17a6 UTSW 7 51661546 missense probably damaging 1.00
R2249:Slc17a6 UTSW 7 51667906 missense probably damaging 1.00
R4283:Slc17a6 UTSW 7 51645076 missense probably damaging 1.00
R4910:Slc17a6 UTSW 7 51658741 missense possibly damaging 0.78
R5301:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R5523:Slc17a6 UTSW 7 51626850 nonsense probably null
R5570:Slc17a6 UTSW 7 51658756 missense probably benign 0.00
R5720:Slc17a6 UTSW 7 51625397 missense probably damaging 1.00
R5736:Slc17a6 UTSW 7 51645093 missense possibly damaging 0.78
R5765:Slc17a6 UTSW 7 51625501 missense possibly damaging 0.93
R6380:Slc17a6 UTSW 7 51667463 missense probably benign 0.02
R6989:Slc17a6 UTSW 7 51661476 missense possibly damaging 0.88
R7178:Slc17a6 UTSW 7 51667511 missense possibly damaging 0.58
R7194:Slc17a6 UTSW 7 51626892 missense probably damaging 1.00
R7325:Slc17a6 UTSW 7 51645018 missense probably damaging 0.96
R7766:Slc17a6 UTSW 7 51669166 missense probably benign 0.06
R7877:Slc17a6 UTSW 7 51625505 missense probably benign 0.00
R7898:Slc17a6 UTSW 7 51658825 splice site probably null
R8788:Slc17a6 UTSW 7 51649160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATTGCTTTTGGCCTACC -3'
(R):5'- TGACCACCTTGTATTTCCAGTG -3'

Sequencing Primer
(F):5'- GATTGCTTTTGGCCTACCCTTTTG -3'
(R):5'- TTGATGCCACCCTGTAGT -3'
Posted On2020-01-23