Incidental Mutation 'R8059:Olfr480'
ID619598
Institutional Source Beutler Lab
Gene Symbol Olfr480
Ensembl Gene ENSMUSG00000063120
Gene Nameolfactory receptor 480
SynonymsGA_x6K02T2PBJ9-10395807-10394869, MOR204-32
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108064878-108067346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108066016 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 231 (T231A)
Ref Sequence ENSEMBL: ENSMUSP00000149301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071658] [ENSMUST00000217653]
Predicted Effect probably benign
Transcript: ENSMUST00000071658
AA Change: T261A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000071583
Gene: ENSMUSG00000063120
AA Change: T261A

DomainStartEndE-ValueType
Pfam:7tm_4 61 338 1.7e-50 PFAM
Pfam:7tm_1 71 320 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217653
AA Change: T231A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Olfr480
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Olfr480 APN 7 108066288 missense probably benign 0.32
IGL02060:Olfr480 APN 7 108066671 missense probably benign 0.03
IGL02392:Olfr480 APN 7 108066503 missense probably benign 0.10
IGL02493:Olfr480 APN 7 108065805 missense possibly damaging 0.79
IGL02634:Olfr480 APN 7 108066771 missense probably benign 0.00
F5770:Olfr480 UTSW 7 108066678 missense probably benign 0.11
R0446:Olfr480 UTSW 7 108066725 nonsense probably null
R1070:Olfr480 UTSW 7 108066651 missense probably benign 0.00
R1510:Olfr480 UTSW 7 108066528 missense probably damaging 1.00
R1862:Olfr480 UTSW 7 108066725 nonsense probably null
R1863:Olfr480 UTSW 7 108066725 nonsense probably null
R1885:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R1886:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R1887:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R3609:Olfr480 UTSW 7 108066369 missense probably damaging 1.00
R3921:Olfr480 UTSW 7 108065901 missense possibly damaging 0.94
R4259:Olfr480 UTSW 7 108065893 nonsense probably null
R5276:Olfr480 UTSW 7 108066216 nonsense probably null
R6224:Olfr480 UTSW 7 108066742 missense probably benign 0.00
R8229:Olfr480 UTSW 7 108066587 missense probably benign 0.01
R8271:Olfr480 UTSW 7 108065773 missense probably damaging 0.99
R8926:Olfr480 UTSW 7 108066306 missense probably benign 0.06
V7581:Olfr480 UTSW 7 108066678 missense probably benign 0.11
X0021:Olfr480 UTSW 7 108066588 missense probably benign 0.01
X0066:Olfr480 UTSW 7 108066435 missense probably benign 0.00
Z1088:Olfr480 UTSW 7 108066327 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAACATGGGGATCACCAC -3'
(R):5'- TTCCTACCTAGGTGGATGGG -3'

Sequencing Primer
(F):5'- CATGGGGATCACCACTGTGTAAAAC -3'
(R):5'- AAATCTGTCATTTTGTGGGCC -3'
Posted On2020-01-23