Incidental Mutation 'R8059:Mtmr7'
ID619599
Institutional Source Beutler Lab
Gene Symbol Mtmr7
Ensembl Gene ENSMUSG00000039431
Gene Namemyotubularin related protein 7
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location40551095-40634797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40581522 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 253 (A253T)
Ref Sequence ENSEMBL: ENSMUSP00000043851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048890] [ENSMUST00000048898] [ENSMUST00000173487] [ENSMUST00000173957] [ENSMUST00000174205]
Predicted Effect probably damaging
Transcript: ENSMUST00000048890
AA Change: A253T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043367
Gene: ENSMUSG00000039431
AA Change: A253T

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 4.9e-145 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048898
AA Change: A253T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043851
Gene: ENSMUSG00000039431
AA Change: A253T

DomainStartEndE-ValueType
Pfam:Myotub-related 109 448 1.6e-143 PFAM
coiled coil region 514 553 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173487
AA Change: A89T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134281
Gene: ENSMUSG00000039431
AA Change: A89T

DomainStartEndE-ValueType
Pfam:Myotub-related 1 286 8.1e-125 PFAM
coiled coil region 350 383 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173957
AA Change: A212T

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134020
Gene: ENSMUSG00000039431
AA Change: A212T

DomainStartEndE-ValueType
Pfam:Myotub-related 67 260 4e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174205
AA Change: A253T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134731
Gene: ENSMUSG00000039431
AA Change: A253T

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 7.2e-145 PFAM
Meta Mutation Damage Score 0.1694 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin family of tyrosine/dual-specificity phosphatases. The encoded protein is characterized by four distinct domains that are conserved among all members of the myotubularin family: the glucosyltransferase, Rab-like GTPase activator and myotubularins domain, the Rac-induced recruitment domain, the protein tyrosine phosphatases and dual-specificity phosphatases domain and the suppressor of variegation 3-9, enhancer-of-zeste, and trithorax interaction domain. This protein dephosphorylates the target substrates phosphatidylinositol 3-phosphate and inositol 1,3-bisphosphate. A pseudogene of this gene is found on chromosome 5. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Mtmr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Mtmr7 APN 8 40597345 missense probably damaging 1.00
IGL01340:Mtmr7 APN 8 40597422 missense probably damaging 1.00
IGL01773:Mtmr7 APN 8 40581419 missense probably damaging 1.00
IGL02040:Mtmr7 APN 8 40560885 missense probably benign 0.01
IGL02195:Mtmr7 APN 8 40560905 missense probably damaging 0.96
IGL03394:Mtmr7 APN 8 40608929 missense probably damaging 0.97
BB001:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
BB003:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
BB011:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
BB013:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R0116:Mtmr7 UTSW 8 40581405 splice site probably benign
R0379:Mtmr7 UTSW 8 40551601 missense probably damaging 1.00
R1443:Mtmr7 UTSW 8 40560882 missense probably damaging 1.00
R1763:Mtmr7 UTSW 8 40551811 missense probably benign
R4372:Mtmr7 UTSW 8 40554345 missense probably damaging 1.00
R4482:Mtmr7 UTSW 8 40554384 missense probably benign 0.32
R4502:Mtmr7 UTSW 8 40558162 missense possibly damaging 0.94
R4622:Mtmr7 UTSW 8 40581541 missense probably damaging 1.00
R4833:Mtmr7 UTSW 8 40590462 missense probably damaging 1.00
R4849:Mtmr7 UTSW 8 40608997 missense probably benign 0.00
R4991:Mtmr7 UTSW 8 40554345 missense probably damaging 1.00
R5424:Mtmr7 UTSW 8 40606830 missense probably benign
R5707:Mtmr7 UTSW 8 40558162 missense possibly damaging 0.94
R5929:Mtmr7 UTSW 8 40558358 critical splice acceptor site probably null
R5985:Mtmr7 UTSW 8 40551832 missense probably benign
R6013:Mtmr7 UTSW 8 40581528 missense probably damaging 1.00
R6249:Mtmr7 UTSW 8 40581482 missense probably damaging 1.00
R7052:Mtmr7 UTSW 8 40555833 missense possibly damaging 0.83
R7249:Mtmr7 UTSW 8 40590477 missense probably benign 0.11
R7538:Mtmr7 UTSW 8 40597384 missense probably damaging 1.00
R7698:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7699:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7699:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7700:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7708:Mtmr7 UTSW 8 40590511 missense probably damaging 0.98
R7890:Mtmr7 UTSW 8 40551735 missense possibly damaging 0.91
R7924:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7926:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R8446:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R8493:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
Z1177:Mtmr7 UTSW 8 40597379 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTCACCACACTTGTTTAACAG -3'
(R):5'- TATGCTTGCACTGAGAGCTCTG -3'

Sequencing Primer
(F):5'- TCACCACACTTGTTTAACAGTATCAC -3'
(R):5'- CTTGCACTGAGAGCTCTGTACAG -3'
Posted On2020-01-23