Incidental Mutation 'R8059:Phlpp2'
ID619601
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene NamePH domain and leucine rich repeat protein phosphatase 2
SynonymsC130044A18Rik, Phlppl
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R8059 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location109868542-109944671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109895557 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 144 (S144T)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
Predicted Effect probably benign
Transcript: ENSMUST00000034175
AA Change: S109T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: S109T

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179721
AA Change: S144T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: S144T

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109925790 missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109937097 missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109934065 missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109939859 missense probably benign
IGL02105:Phlpp2 APN 8 109904408 missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109920099 missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109939873 missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109913618 missense probably benign
IGL03356:Phlpp2 APN 8 109935617 missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109940835 missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109939935 missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109928463 missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109895506 critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109876971 missense probably benign 0.00
R0605:Phlpp2 UTSW 8 109933211 missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109895587 missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109877030 nonsense probably null
R1417:Phlpp2 UTSW 8 109940681 nonsense probably null
R1602:Phlpp2 UTSW 8 109934023 missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 109933955 splice site probably benign
R1815:Phlpp2 UTSW 8 109940223 missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109907600 missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109940002 missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109907613 missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109876883 missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109940820 missense probably benign 0.31
R4739:Phlpp2 UTSW 8 109940420 missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 109877010 missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 109940082 missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109913619 missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109925829 missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109934035 missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109904344 missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109928573 missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109934685 missense probably benign
R6470:Phlpp2 UTSW 8 109937194 missense probably benign 0.45
R6804:Phlpp2 UTSW 8 109928565 missense probably damaging 1.00
R7012:Phlpp2 UTSW 8 109876854 missense possibly damaging 0.95
R7183:Phlpp2 UTSW 8 109939953 missense probably damaging 1.00
R7257:Phlpp2 UTSW 8 109940188 missense probably benign
R7312:Phlpp2 UTSW 8 109940153 missense probably damaging 0.96
R7349:Phlpp2 UTSW 8 109928646 missense probably damaging 0.98
R7801:Phlpp2 UTSW 8 109925842 missense possibly damaging 0.56
R8242:Phlpp2 UTSW 8 109940202 missense probably benign 0.03
X0018:Phlpp2 UTSW 8 109912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCATGTGGCAGTGCTCAC -3'
(R):5'- GCAAATACTTTTAGCACACAGAAAG -3'

Sequencing Primer
(F):5'- TACACACACGCACGCATG -3'
(R):5'- CGAATCATACAGCTGAGG -3'
Posted On2020-01-23