Incidental Mutation 'R8059:Nek11'
ID619603
Institutional Source Beutler Lab
Gene Symbol Nek11
Ensembl Gene ENSMUSG00000035032
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 11
Synonyms4932416N14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location105162156-105395524 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 105162974 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 629 (*629W)
Ref Sequence ENSEMBL: ENSMUSP00000038611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038648] [ENSMUST00000177029]
Predicted Effect probably null
Transcript: ENSMUST00000038648
AA Change: *629W
SMART Domains Protein: ENSMUSP00000038611
Gene: ENSMUSG00000035032
AA Change: *629W

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
coiled coil region 348 384 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177029
SMART Domains Protein: ENSMUSP00000135837
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
SCOP:d1h8fa_ 11 80 1e-6 SMART
Blast:S_TKc 30 70 1e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the never in mitosis gene A family of kinases. The encoded protein localizes to the nucleoli, and may function with NEK2A in the S-phase checkpoint. The encoded protein appears to play roles in DNA replication and response to genotoxic stress. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Nek11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Nek11 APN 9 105392913 missense probably damaging 1.00
IGL01369:Nek11 APN 9 105300060 critical splice donor site probably null
IGL01958:Nek11 APN 9 105300303 missense probably benign 0.06
IGL03099:Nek11 APN 9 105287653 missense probably benign 0.02
IGL03256:Nek11 APN 9 105244414 missense probably damaging 1.00
IGL03400:Nek11 APN 9 105204866 missense probably benign 0.01
R0051:Nek11 UTSW 9 105218539 splice site probably benign
R0051:Nek11 UTSW 9 105218539 splice site probably benign
R0194:Nek11 UTSW 9 105392952 missense probably benign 0.05
R0942:Nek11 UTSW 9 105295371 splice site probably null
R1226:Nek11 UTSW 9 105392892 missense probably damaging 1.00
R1503:Nek11 UTSW 9 105163204 missense probably damaging 1.00
R1709:Nek11 UTSW 9 105348061 missense probably damaging 1.00
R1958:Nek11 UTSW 9 105293717 missense probably benign 0.00
R2128:Nek11 UTSW 9 105300361 missense probably benign 0.01
R3754:Nek11 UTSW 9 105314718 missense probably damaging 1.00
R4027:Nek11 UTSW 9 105244390 nonsense probably null
R4594:Nek11 UTSW 9 105392847 critical splice donor site probably null
R4650:Nek11 UTSW 9 105348080 missense possibly damaging 0.79
R4724:Nek11 UTSW 9 105392970 missense possibly damaging 0.89
R4846:Nek11 UTSW 9 105163163 missense probably damaging 1.00
R4903:Nek11 UTSW 9 105314722 missense possibly damaging 0.63
R4908:Nek11 UTSW 9 105298289 missense probably benign 0.00
R4912:Nek11 UTSW 9 105287658 missense probably benign 0.01
R4930:Nek11 UTSW 9 105300066 missense probably damaging 1.00
R5827:Nek11 UTSW 9 105314745 missense probably damaging 1.00
R5860:Nek11 UTSW 9 105392961 missense probably benign 0.01
R6030:Nek11 UTSW 9 105204888 critical splice acceptor site probably null
R6030:Nek11 UTSW 9 105204888 critical splice acceptor site probably null
R6154:Nek11 UTSW 9 105323169 makesense probably null
R6915:Nek11 UTSW 9 105393057 unclassified probably benign
R7197:Nek11 UTSW 9 105244415 missense probably damaging 1.00
R8140:Nek11 UTSW 9 105392957 missense probably damaging 0.99
R8357:Nek11 UTSW 9 105347992 missense probably damaging 1.00
R8457:Nek11 UTSW 9 105347992 missense probably damaging 1.00
R8536:Nek11 UTSW 9 105298339 missense probably benign 0.04
R8752:Nek11 UTSW 9 105348008 missense probably benign 0.00
R8885:Nek11 UTSW 9 105295372 critical splice donor site probably null
Z1176:Nek11 UTSW 9 105293669 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTGTGTCTTCAGAGTGCTCC -3'
(R):5'- CAGAGATCTGGGAGCATCTG -3'

Sequencing Primer
(F):5'- GCATACTGGAAACCCCGAGG -3'
(R):5'- TCTGGGAGCATCTGGAGAC -3'
Posted On2020-01-23