Mutagenetix > Incidental Mutation

Incidental Mutation 'R8059:Lrrn3'

619611

Institutional Source

Beutler Lab

Gene Symbol

Lrrn3

Ensembl Gene

ENSMUSG00000036295

Gene Name

leucine rich repeat protein 3, neuronal

Synonyms

NLRR-3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.211) question?

Stock #

R8059 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41451668-41486431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 41454217 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 34 (T34A)

Ref Sequence

ENSEMBL: ENSMUSP00000043818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]

AlphaFold

Q8CBC6

Predicted Effect

probably benign
Transcript: ENSMUST00000043884
AA Change: T34A

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: T34A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	28	73	9.17e-4	SMART
LRR	115	138	2.63e0	SMART
LRR_TYP	139	162	1.5e-4	SMART
LRR	163	186	7.55e-1	SMART
LRR	187	210	1.76e1	SMART
LRR	211	234	1.62e1	SMART
LRR	235	258	5.11e0	SMART
LRR	260	282	3.18e1	SMART
LRR	333	356	4.44e0	SMART
LRRCT	368	420	3.7e-5	SMART
IGc2	435	503	5.04e-9	SMART
FN3	521	602	3.49e0	SMART
transmembrane domain	626	648	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132121

SMART Domains

Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	115	7.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134965

SMART Domains

Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	114	6.4e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,279	M3372K	probably benign	Het
Abcg3	A	T	5: 104,953,082		probably null	Het
Adam19	G	A	11: 46,136,466		probably benign	Het
Adgrg6	G	T	10: 14,469,050	T53K	probably damaging	Het
Ccdc141	A	C	2: 77,044,751	L705R	probably damaging	Het
Cep78	A	T	19: 15,981,512	V156E	probably benign	Het
Cers2	A	G	3: 95,322,671	D342G	probably damaging	Het
Chl1	T	A	6: 103,674,987	I272N	probably damaging	Het
Defb30	A	G	14: 63,035,934	*77Q	probably null	Het
Dnm3	A	G	1: 162,084,139	V63A	probably damaging	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Entpd2	G	T	2: 25,398,084	V107L	probably damaging	Het
Hectd1	T	A	12: 51,790,378	H799L	possibly damaging	Het
Hira	T	C	16: 18,912,151	V200A	probably damaging	Het
Hspd1	T	C	1: 55,081,724	K269E	possibly damaging	Het
Kcnj4	T	C	15: 79,484,802	S326G	probably benign	Het
Kctd19	T	G	8: 105,396,351	I144L	probably benign	Het
Lama4	T	C	10: 38,966,061	I36T	probably benign	Het
Maml3	A	G	3: 51,856,689	S285P	probably damaging	Het
Man2b2	A	G	5: 36,816,160	Y492H	probably damaging	Het
Mapk10	G	T	5: 102,966,612	N303K	probably damaging	Het
Matn2	C	T	15: 34,345,335	R163C	probably damaging	Het
Mtmr7	C	T	8: 40,581,522	A253T	probably damaging	Het
Naca	C	T	10: 128,040,503	P468L	unknown	Het
Nckap1l	T	C	15: 103,493,287	S1084P	possibly damaging	Het
Nek11	T	C	9: 105,162,974	*629W	probably null	Het
Nfkb1	C	T	3: 135,593,852	A731T	possibly damaging	Het
Nop2	T	C	6: 125,140,812	V442A	probably damaging	Het
Oaz2	C	T	9: 65,689,143	P163L	probably damaging	Het
Olfr1056	A	G	2: 86,355,962	V140A	probably benign	Het
Olfr214	C	T	6: 116,556,473	T16I	possibly damaging	Het
Olfr480	T	C	7: 108,066,016	T231A	probably benign	Het
Pabpc2	A	T	18: 39,774,822	N380I	probably benign	Het
Pax3	T	C	1: 78,103,366	D461G	probably benign	Het
Pds5b	G	T	5: 150,807,835	R1443L	unknown	Het
Per1	G	A	11: 69,106,483	R828H	probably damaging	Het
Phlpp2	T	A	8: 109,895,557	S144T	probably benign	Het
Plod1	A	T	4: 147,928,484	I207N	probably damaging	Het
Psmc6	A	T	14: 45,340,803	I208F	probably damaging	Het
Rev3l	T	C	10: 39,843,495	S2494P	probably damaging	Het
Rgs3	T	C	4: 62,602,977		probably benign	Het
Rtraf	T	C	14: 19,822,563		probably benign	Het
Slc17a6	T	A	7: 51,645,044	N166K	probably damaging	Het
Slc18a2	A	T	19: 59,284,140	T348S	probably benign	Het
Slc39a8	G	T	3: 135,826,586	A39S	probably benign	Het
Slc8a3	C	T	12: 81,202,258	G799S	probably damaging	Het
Sp1	T	G	15: 102,407,902	S46R	possibly damaging	Het
Spta1	A	G	1: 174,218,370		probably benign	Het
Stab1	G	A	14: 31,160,241	P499L	probably benign	Het
Tmem57	A	T	4: 134,828,048	C371*	probably null	Het
Trav21-dv12	C	A	14: 53,876,721	D99E	probably damaging	Het
Trpv6	T	G	6: 41,624,586	I467L	probably benign	Het
Ttc41	A	G	10: 86,712,978	Y12C	probably benign	Het
Vmn1r233	T	C	17: 20,994,436	N84S	probably benign	Het
Vrtn	T	C	12: 84,649,916	F480S	probably benign	Het
Wdr63	C	G	3: 146,046,673	R749S	possibly damaging	Het
Zc3h13	C	G	14: 75,327,810	R788G	unknown	Het

Other mutations in Lrrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Lrrn3	APN	12	41452192	intron	probably benign
IGL02825:Lrrn3	APN	12	41452593	missense	probably damaging	1.00
IGL02927:Lrrn3	APN	12	41453344	missense	probably damaging	1.00
IGL02970:Lrrn3	APN	12	41452360	missense	probably benign
IGL02995:Lrrn3	APN	12	41452217	missense	probably damaging	1.00
IGL02999:Lrrn3	APN	12	41452751	missense	probably benign	0.01
IGL03182:Lrrn3	APN	12	41454021	missense	probably damaging	1.00
IGL03280:Lrrn3	APN	12	41454147	missense	probably damaging	0.97
PIT4469001:Lrrn3	UTSW	12	41453018	missense	probably benign	0.03
R0167:Lrrn3	UTSW	12	41454015	missense	probably damaging	1.00
R0414:Lrrn3	UTSW	12	41453940	missense	probably damaging	1.00
R0787:Lrrn3	UTSW	12	41454231	missense	probably damaging	1.00
R0894:Lrrn3	UTSW	12	41454034	missense	probably damaging	1.00
R1433:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R1610:Lrrn3	UTSW	12	41452993	missense	possibly damaging	0.89
R1834:Lrrn3	UTSW	12	41453518	missense	probably damaging	1.00
R2068:Lrrn3	UTSW	12	41452996	missense	probably damaging	1.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R3771:Lrrn3	UTSW	12	41452870	missense	probably damaging	1.00
R4408:Lrrn3	UTSW	12	41454042	missense	probably benign	0.04
R4410:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R4684:Lrrn3	UTSW	12	41454244	missense	possibly damaging	0.75
R4770:Lrrn3	UTSW	12	41452443	missense	probably benign	0.08
R4927:Lrrn3	UTSW	12	41453125	missense	probably damaging	1.00
R5037:Lrrn3	UTSW	12	41453595	missense	probably damaging	1.00
R5482:Lrrn3	UTSW	12	41452387	missense	probably benign	0.01
R5482:Lrrn3	UTSW	12	41452388	missense	probably damaging	0.96
R5667:Lrrn3	UTSW	12	41452298	missense	possibly damaging	0.77
R6022:Lrrn3	UTSW	12	41453430	missense	probably damaging	0.96
R6087:Lrrn3	UTSW	12	41453535	missense	possibly damaging	0.84
R6129:Lrrn3	UTSW	12	41453788	nonsense	probably null
R6309:Lrrn3	UTSW	12	41453206	missense	probably damaging	1.00
R7449:Lrrn3	UTSW	12	41453488	missense	probably damaging	1.00
R7555:Lrrn3	UTSW	12	41452911	missense	probably benign	0.01
R7560:Lrrn3	UTSW	12	41452713	missense	possibly damaging	0.93
R8134:Lrrn3	UTSW	12	41453048	missense	probably damaging	1.00
R8798:Lrrn3	UTSW	12	41453175	missense	possibly damaging	0.61
R9308:Lrrn3	UTSW	12	41453946	missense	probably damaging	1.00
R9318:Lrrn3	UTSW	12	41453244	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGTTCACTGGGAAGTCTGTG -3'
(R):5'- GTGGTGTTCATCTTTTGACAAATGC -3'

Sequencing Primer
(F):5'- AAGTCTGTGGAATGTTCAATTCTTGC -3'
(R):5'- TGCAAATACTTCCCTCATCAGTCAG -3'

Posted On

2020-01-23