Incidental Mutation 'R8059:Slc8a3'
ID619613
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 3
SynonymsNcx3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81197915-81333180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81202258 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 799 (G799S)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]
Predicted Effect
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: G798S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085238
AA Change: G792S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: G792S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182208
AA Change: G799S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: G799S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182366
SMART Domains Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055

DomainStartEndE-ValueType
PDB:2LT9|A 1 52 2e-28 PDB
low complexity region 82 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81314569 missense probably benign
IGL01315:Slc8a3 APN 12 81314395 missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81315376 missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81315802 missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81315683 missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81315224 missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81204156 splice site probably benign
IGL02646:Slc8a3 APN 12 81315094 missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81202249 missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81315265 missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81314842 missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81316016 missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1557:Slc8a3 UTSW 12 81315557 missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81205007 missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81314844 missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81315220 missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81202339 missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81315179 missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81204138 missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81314872 missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81315176 missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81315853 missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81314851 missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81314699 missense probably benign 0.31
R4951:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R5022:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81214132 missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81214134 missense probably null 0.34
R5122:Slc8a3 UTSW 12 81314258 critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81314491 missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81199631 missense probably damaging 1.00
R6062:Slc8a3 UTSW 12 81314350 missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81199567 missense probably benign
R6279:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81315627 missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81314432 missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81314755 missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81314273 missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81315053 missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81216824 missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81315805 missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81314803 missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81214058 splice site probably null
R7549:Slc8a3 UTSW 12 81314770 missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81314384 missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81314473 missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81314551 missense probably benign
R7960:Slc8a3 UTSW 12 81216732 missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81314993 missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81199681 missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81199768 missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81314678 missense probably damaging 0.97
R8681:Slc8a3 UTSW 12 81315140 missense probably benign
X0026:Slc8a3 UTSW 12 81315287 missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81314943 missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81314700 missense possibly damaging 0.92
Z1177:Slc8a3 UTSW 12 81315876 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACTTGGTAGGCCTCAGTTTC -3'
(R):5'- ACGTCATGCACTTCCTGACG -3'

Sequencing Primer
(F):5'- CCCCTGTCTAGTAAGGCTTGG -3'
(R):5'- CCTGACGGTCTTCTGGAAG -3'
Posted On2020-01-23