Mutagenetix > Incidental Mutation

Incidental Mutation 'R8059:Slc8a3'

619613

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8059 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 81202258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 799 (G799S)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]

AlphaFold

S4R2P9

Predicted Effect

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: G798S

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: G792S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: G792S

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: G799S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: G799S

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182366

SMART Domains

Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055

Domain	Start	End	E-Value	Type
PDB:2LT9\|A	1	52	2e-28	PDB
low complexity region	82	93	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,279	M3372K	probably benign	Het
Abcg3	A	T	5: 104,953,082		probably null	Het
Adam19	G	A	11: 46,136,466		probably benign	Het
Adgrg6	G	T	10: 14,469,050	T53K	probably damaging	Het
Ccdc141	A	C	2: 77,044,751	L705R	probably damaging	Het
Cep78	A	T	19: 15,981,512	V156E	probably benign	Het
Cers2	A	G	3: 95,322,671	D342G	probably damaging	Het
Chl1	T	A	6: 103,674,987	I272N	probably damaging	Het
Defb30	A	G	14: 63,035,934	*77Q	probably null	Het
Dnm3	A	G	1: 162,084,139	V63A	probably damaging	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Entpd2	G	T	2: 25,398,084	V107L	probably damaging	Het
Hectd1	T	A	12: 51,790,378	H799L	possibly damaging	Het
Hira	T	C	16: 18,912,151	V200A	probably damaging	Het
Hspd1	T	C	1: 55,081,724	K269E	possibly damaging	Het
Kcnj4	T	C	15: 79,484,802	S326G	probably benign	Het
Kctd19	T	G	8: 105,396,351	I144L	probably benign	Het
Lama4	T	C	10: 38,966,061	I36T	probably benign	Het
Lrrn3	T	C	12: 41,454,217	T34A	probably benign	Het
Maml3	A	G	3: 51,856,689	S285P	probably damaging	Het
Man2b2	A	G	5: 36,816,160	Y492H	probably damaging	Het
Mapk10	G	T	5: 102,966,612	N303K	probably damaging	Het
Matn2	C	T	15: 34,345,335	R163C	probably damaging	Het
Mtmr7	C	T	8: 40,581,522	A253T	probably damaging	Het
Naca	C	T	10: 128,040,503	P468L	unknown	Het
Nckap1l	T	C	15: 103,493,287	S1084P	possibly damaging	Het
Nek11	T	C	9: 105,162,974	*629W	probably null	Het
Nfkb1	C	T	3: 135,593,852	A731T	possibly damaging	Het
Nop2	T	C	6: 125,140,812	V442A	probably damaging	Het
Oaz2	C	T	9: 65,689,143	P163L	probably damaging	Het
Olfr1056	A	G	2: 86,355,962	V140A	probably benign	Het
Olfr214	C	T	6: 116,556,473	T16I	possibly damaging	Het
Olfr480	T	C	7: 108,066,016	T231A	probably benign	Het
Pabpc2	A	T	18: 39,774,822	N380I	probably benign	Het
Pax3	T	C	1: 78,103,366	D461G	probably benign	Het
Pds5b	G	T	5: 150,807,835	R1443L	unknown	Het
Per1	G	A	11: 69,106,483	R828H	probably damaging	Het
Phlpp2	T	A	8: 109,895,557	S144T	probably benign	Het
Plod1	A	T	4: 147,928,484	I207N	probably damaging	Het
Psmc6	A	T	14: 45,340,803	I208F	probably damaging	Het
Rev3l	T	C	10: 39,843,495	S2494P	probably damaging	Het
Rgs3	T	C	4: 62,602,977		probably benign	Het
Rtraf	T	C	14: 19,822,563		probably benign	Het
Slc17a6	T	A	7: 51,645,044	N166K	probably damaging	Het
Slc18a2	A	T	19: 59,284,140	T348S	probably benign	Het
Slc39a8	G	T	3: 135,826,586	A39S	probably benign	Het
Sp1	T	G	15: 102,407,902	S46R	possibly damaging	Het
Spta1	A	G	1: 174,218,370		probably benign	Het
Stab1	G	A	14: 31,160,241	P499L	probably benign	Het
Tmem57	A	T	4: 134,828,048	C371*	probably null	Het
Trav21-dv12	C	A	14: 53,876,721	D99E	probably damaging	Het
Trpv6	T	G	6: 41,624,586	I467L	probably benign	Het
Ttc41	A	G	10: 86,712,978	Y12C	probably benign	Het
Vmn1r233	T	C	17: 20,994,436	N84S	probably benign	Het
Vrtn	T	C	12: 84,649,916	F480S	probably benign	Het
Wdr63	C	G	3: 146,046,673	R749S	possibly damaging	Het
Zc3h13	C	G	14: 75,327,810	R788G	unknown	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- ACTTGGTAGGCCTCAGTTTC -3'
(R):5'- ACGTCATGCACTTCCTGACG -3'

Sequencing Primer
(F):5'- CCCCTGTCTAGTAAGGCTTGG -3'
(R):5'- CCTGACGGTCTTCTGGAAG -3'

Posted On

2020-01-23