Incidental Mutation 'R8059:Kcnj4'
ID619621
Institutional Source Beutler Lab
Gene Symbol Kcnj4
Ensembl Gene ENSMUSG00000044216
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 4
SynonymsMB-IRK3, Kir 2.3, Kcnf2, IRK3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location79483714-79505241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79484802 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 326 (S326G)
Ref Sequence ENSEMBL: ENSMUSP00000094075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057801]
Predicted Effect probably benign
Transcript: ENSMUST00000057801
AA Change: S326G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094075
Gene: ENSMUSG00000044216
AA Change: S326G

DomainStartEndE-ValueType
Pfam:IRK 22 361 2.1e-155 PFAM
coiled coil region 371 400 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Kcnj4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Kcnj4 APN 15 79484579 missense probably benign 0.01
IGL02263:Kcnj4 APN 15 79485787 utr 5 prime probably benign
IGL02551:Kcnj4 APN 15 79484902 missense probably benign 0.05
R1305:Kcnj4 UTSW 15 79484819 missense probably damaging 1.00
R1464:Kcnj4 UTSW 15 79485404 missense probably damaging 1.00
R1464:Kcnj4 UTSW 15 79485404 missense probably damaging 1.00
R1475:Kcnj4 UTSW 15 79484630 missense probably damaging 1.00
R1844:Kcnj4 UTSW 15 79485015 missense probably damaging 1.00
R3906:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
R3907:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
R3908:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
R4396:Kcnj4 UTSW 15 79484673 missense probably benign 0.06
R7598:Kcnj4 UTSW 15 79485764 missense probably benign 0.00
R8371:Kcnj4 UTSW 15 79485141 missense probably damaging 1.00
R8818:Kcnj4 UTSW 15 79485719 missense probably damaging 1.00
X0062:Kcnj4 UTSW 15 79485690 missense probably benign 0.06
Z1177:Kcnj4 UTSW 15 79485169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTGGAACCTGCCTCCAG -3'
(R):5'- CATAGTGCATGAAATCGACGAG -3'

Sequencing Primer
(F):5'- GCCGCAGCCTCCTCTTC -3'
(R):5'- TGAAATCGACGAGGACAGCCC -3'
Posted On2020-01-23