Incidental Mutation 'R8059:Sp1'
ID619622
Institutional Source Beutler Lab
Gene Symbol Sp1
Ensembl Gene ENSMUSG00000001280
Gene Nametrans-acting transcription factor 1
SynonymsSp1-1, 1110003E12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102406143-102436404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102407902 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 46 (S46R)
Ref Sequence ENSEMBL: ENSMUSP00000001326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001326] [ENSMUST00000163709] [ENSMUST00000165837] [ENSMUST00000168802] [ENSMUST00000169619] [ENSMUST00000170884]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001326
AA Change: S46R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001326
Gene: ENSMUSG00000001280
AA Change: S46R

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 37 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 279 296 N/A INTRINSIC
low complexity region 300 333 N/A INTRINSIC
low complexity region 341 354 N/A INTRINSIC
low complexity region 370 422 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
ZnF_C2H2 624 648 4.34e0 SMART
ZnF_C2H2 654 678 1.98e-4 SMART
ZnF_C2H2 684 706 1.12e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163709
AA Change: S46R
SMART Domains Protein: ENSMUSP00000130747
Gene: ENSMUSG00000001280
AA Change: S46R

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 37 108 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
ZnF_C2H2 310 334 4.34e0 SMART
ZnF_C2H2 340 364 1.98e-4 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165837
AA Change: S39R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126143
Gene: ENSMUSG00000001280
AA Change: S39R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168802
AA Change: S39R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127445
Gene: ENSMUSG00000001280
AA Change: S39R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169619
AA Change: S39R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127714
Gene: ENSMUSG00000001280
AA Change: S39R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170884
AA Change: S39R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129638
Gene: ENSMUSG00000001280
AA Change: S39R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to GC-rich motifs of many promoters. The encoded protein is involved in many cellular processes, including cell differentiation, cell growth, apoptosis, immune responses, response to DNA damage, and chromatin remodeling. Post-translational modifications such as phosphorylation, acetylation, glycosylation, and proteolytic processing significantly affect the activity of this protein, which can be an activator or a repressor. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display reduced embryo size and die during organogenesis with a broad range of developmental defects. Heterozygous null mice are viable but slightly growth retarded, may lack one or both eyes, and show a decreased erythroid progenitor cell number in fetal liver cultures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Sp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Sp1 APN 15 102430929 missense probably damaging 1.00
PIT4812001:Sp1 UTSW 15 102408408 missense possibly damaging 0.53
R0758:Sp1 UTSW 15 102406370 splice site probably null
R1509:Sp1 UTSW 15 102407879 missense possibly damaging 0.66
R1611:Sp1 UTSW 15 102430935 missense probably damaging 0.99
R1820:Sp1 UTSW 15 102409076 missense possibly damaging 0.73
R1824:Sp1 UTSW 15 102431003 missense possibly damaging 0.70
R2107:Sp1 UTSW 15 102409678 splice site probably null
R4508:Sp1 UTSW 15 102409312 missense possibly damaging 0.53
R4857:Sp1 UTSW 15 102430974 missense probably damaging 0.99
R5512:Sp1 UTSW 15 102431010 missense possibly damaging 0.91
R5559:Sp1 UTSW 15 102408930 missense probably benign 0.18
R5833:Sp1 UTSW 15 102430917 missense possibly damaging 0.92
R6377:Sp1 UTSW 15 102430883 missense probably benign 0.13
R8434:Sp1 UTSW 15 102409683 missense probably benign 0.00
R8537:Sp1 UTSW 15 102408529 missense possibly damaging 0.86
X0050:Sp1 UTSW 15 102409411 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATTGCTGACGGTCAAATCC -3'
(R):5'- TCCAACTTTCGTATCTGGGGAC -3'

Sequencing Primer
(F):5'- ATGTTGTTTTTAACACACCCCC -3'
(R):5'- GGGACCCTCTAGATCACCTATC -3'
Posted On2020-01-23