Incidental Mutation 'R8059:Cep78'
ID619628
Institutional Source Beutler Lab
Gene Symbol Cep78
Ensembl Gene ENSMUSG00000041491
Gene Namecentrosomal protein 78
Synonyms5730599I05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R8059 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location15955774-15984989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15981512 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 156 (V156E)
Ref Sequence ENSEMBL: ENSMUSP00000037596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047704]
Predicted Effect probably benign
Transcript: ENSMUST00000047704
AA Change: V156E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037596
Gene: ENSMUSG00000041491
AA Change: V156E

DomainStartEndE-ValueType
LRR 152 179 2.95e-3 SMART
Blast:LRR 180 207 1e-10 BLAST
LRR 231 259 6.28e-1 SMART
LRR 260 287 8.81e-2 SMART
LRR 288 313 1.96e2 SMART
low complexity region 427 450 N/A INTRINSIC
coiled coil region 462 511 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Cep78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cep78 APN 19 15969140 missense probably benign
IGL00920:Cep78 APN 19 15981486 missense probably benign 0.03
IGL01548:Cep78 APN 19 15981200 splice site probably benign
IGL01662:Cep78 APN 19 15960995 missense probably damaging 1.00
IGL01933:Cep78 APN 19 15955940 missense probably benign
IGL02014:Cep78 APN 19 15984738 missense probably damaging 1.00
IGL02198:Cep78 APN 19 15956369 missense probably damaging 1.00
IGL02331:Cep78 APN 19 15974415 missense probably benign 0.16
IGL02431:Cep78 APN 19 15959579 missense probably benign
IGL02731:Cep78 APN 19 15956306 missense probably benign 0.02
IGL03268:Cep78 APN 19 15974442 nonsense probably null
IGL03338:Cep78 APN 19 15959623 missense probably damaging 0.97
himalayas UTSW 19 15969128 missense possibly damaging 0.66
R0426:Cep78 UTSW 19 15970970 nonsense probably null
R0619:Cep78 UTSW 19 15978862 missense probably damaging 0.99
R0659:Cep78 UTSW 19 15956190 missense probably damaging 0.97
R1517:Cep78 UTSW 19 15959663 missense probably damaging 1.00
R1758:Cep78 UTSW 19 15959536 missense probably damaging 1.00
R1836:Cep78 UTSW 19 15969169 missense probably damaging 1.00
R1865:Cep78 UTSW 19 15956004 missense probably damaging 1.00
R1920:Cep78 UTSW 19 15974351 splice site probably benign
R2483:Cep78 UTSW 19 15960980 missense probably damaging 1.00
R2958:Cep78 UTSW 19 15978909 missense probably damaging 1.00
R3814:Cep78 UTSW 19 15981802 critical splice acceptor site probably null
R4133:Cep78 UTSW 19 15969155 missense probably damaging 1.00
R4214:Cep78 UTSW 19 15959579 missense probably benign
R5783:Cep78 UTSW 19 15956359 missense probably benign 0.02
R5791:Cep78 UTSW 19 15961072 missense probably benign 0.19
R5910:Cep78 UTSW 19 15969128 missense possibly damaging 0.66
R5924:Cep78 UTSW 19 15961066 missense probably damaging 1.00
R6148:Cep78 UTSW 19 15981786 nonsense probably null
R6162:Cep78 UTSW 19 15974940 missense probably benign 0.28
R6235:Cep78 UTSW 19 15976486 intron probably null
R6968:Cep78 UTSW 19 15981738 missense probably benign 0.38
R7228:Cep78 UTSW 19 15969197 missense probably benign 0.01
R7913:Cep78 UTSW 19 15970577 missense probably benign
R7994:Cep78 UTSW 19 15970577 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCATCTGAGCAGGCACAG -3'
(R):5'- TTCCAGTTATGTAAGGCTCTTAGAGG -3'

Sequencing Primer
(F):5'- CACAGGAAGGAGGCAGCTC -3'
(R):5'- AGAGGCTGCTTAAGTGTATCAG -3'
Posted On2020-01-23