Incidental Mutation 'R8060:Olfr1258'
ID619635
Institutional Source Beutler Lab
Gene Symbol Olfr1258
Ensembl Gene ENSMUSG00000049149
Gene Nameolfactory receptor 1258
SynonymsGA_x6K02T2Q125-51361752-51362687, MOR232-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8060 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89927309-89936334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89930349 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 180 (N180I)
Ref Sequence ENSEMBL: ENSMUSP00000099669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102609] [ENSMUST00000111516] [ENSMUST00000213720]
Predicted Effect probably benign
Transcript: ENSMUST00000102609
AA Change: N180I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099669
Gene: ENSMUSG00000049149
AA Change: N180I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 6.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111516
AA Change: N180I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107141
Gene: ENSMUSG00000049149
AA Change: N180I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 4.9e-32 PFAM
Pfam:7tm_4 137 278 2.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213720
AA Change: N180I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc A T 7: 97,575,648 Y2* probably null Het
Ano5 T A 7: 51,587,783 V785E probably benign Het
Arhgef10 A T 8: 14,954,446 R399S probably damaging Het
Arhgef40 A G 14: 51,984,995 probably benign Het
Armc3 G T 2: 19,288,909 V504L probably benign Het
Asb10 T A 5: 24,533,835 Y408F probably benign Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccdc112 T C 18: 46,293,462 I131M probably damaging Het
Chrnb3 T A 8: 27,394,560 S442T unknown Het
Cit G A 5: 115,908,727 V400M probably benign Het
Copg1 T C 6: 87,909,721 F772L probably damaging Het
Cts3 T A 13: 61,566,766 I242F probably damaging Het
Dock1 T A 7: 135,168,403 D1797E probably benign Het
Dock1 T A 7: 134,990,629 probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fam171a2 T C 11: 102,438,610 K441R possibly damaging Het
H2-DMa A G 17: 34,137,285 E87G probably benign Het
Has2 T A 15: 56,669,945 M225L probably benign Het
Hnrnpll A G 17: 80,034,105 S502P probably damaging Het
Hnrnpul1 G T 7: 25,748,343 F185L possibly damaging Het
Hoxd11 G A 2: 74,682,376 probably benign Het
Larp1b T C 3: 40,985,402 V330A Het
Mast4 T C 13: 102,737,676 E1728G possibly damaging Het
Minpp1 T A 19: 32,493,903 F284I probably damaging Het
Moxd1 A G 10: 24,301,612 S609G unknown Het
Myh1 A C 11: 67,215,251 M1231L probably benign Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1153 A T 2: 87,896,973 Y258F probably damaging Het
Olfr1178 A G 2: 88,391,504 T86A probably benign Het
Olfr387-ps1 T C 11: 73,664,939 I110T probably benign Het
Olfr476 A G 7: 107,967,405 T3A probably benign Het
Olfr775 A C 10: 129,251,046 T171P possibly damaging Het
Pln A T 10: 53,343,897 I12F unknown Het
Pomt2 G A 12: 87,129,006 A388V probably damaging Het
Rbl2 T A 8: 91,096,869 probably null Het
Rnpep T C 1: 135,266,920 Y459C probably damaging Het
Slc23a4 T C 6: 34,948,401 T498A probably damaging Het
Slc2a4 A T 11: 69,945,010 L338M possibly damaging Het
Smco2 C A 6: 146,866,785 Q221K probably benign Het
Snx20 G T 8: 88,627,645 C152* probably null Het
Spata16 T C 3: 26,840,720 L306P probably damaging Het
Spata20 A T 11: 94,482,239 F520L probably benign Het
Sptbn1 A T 11: 30,101,616 D2290E probably damaging Het
Tnfrsf11b G A 15: 54,254,109 T250I probably benign Het
Trim34a G T 7: 104,260,976 W328C probably damaging Het
Trim42 T G 9: 97,363,479 M423L probably damaging Het
Trpm4 T C 7: 45,305,451 K1055E probably damaging Het
Trpv5 T A 6: 41,674,531 K238* probably null Het
Tshr A C 12: 91,538,360 I691L probably benign Het
Vmn2r-ps117 A T 17: 18,837,862 H560L possibly damaging Het
Other mutations in Olfr1258
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1258 APN 2 89930544 missense probably damaging 0.96
IGL02552:Olfr1258 APN 2 89930559 missense probably benign 0.01
IGL03300:Olfr1258 APN 2 89930227 nonsense probably null
R0081:Olfr1258 UTSW 2 89930079 missense possibly damaging 0.90
R0197:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0701:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0883:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R1163:Olfr1258 UTSW 2 89930105 missense possibly damaging 0.78
R1833:Olfr1258 UTSW 2 89930301 nonsense probably null
R1846:Olfr1258 UTSW 2 89930666 missense possibly damaging 0.45
R4504:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4507:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4679:Olfr1258 UTSW 2 89930664 missense possibly damaging 0.63
R4908:Olfr1258 UTSW 2 89930579 missense probably benign 0.00
R5430:Olfr1258 UTSW 2 89929913 missense probably benign 0.00
R6836:Olfr1258 UTSW 2 89930339 missense probably damaging 1.00
R7552:Olfr1258 UTSW 2 89930720 missense probably benign 0.06
R7709:Olfr1258 UTSW 2 89929881 missense probably benign 0.00
R8349:Olfr1258 UTSW 2 89930534 missense possibly damaging 0.48
R8449:Olfr1258 UTSW 2 89930534 missense possibly damaging 0.48
Z1177:Olfr1258 UTSW 2 89930598 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTGCTTACTGTGATGGCC -3'
(R):5'- CAACAACTGTTATGTGGGAGAC -3'

Sequencing Primer
(F):5'- ATGACCGCTATGTGGCAATC -3'
(R):5'- CACAAGTGGAGAGGGCTTTGC -3'
Posted On2020-01-23