Incidental Mutation 'R8060:Larp1b'
ID619637
Institutional Source Beutler Lab
Gene Symbol Larp1b
Ensembl Gene ENSMUSG00000025762
Gene NameLa ribonucleoprotein domain family, member 1B
SynonymsLarp2, 1700108L22Rik, 4933421B21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8060 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location40950354-41040234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40985402 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 330 (V330A)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc A T 7: 97,575,648 Y2* probably null Het
Ano5 T A 7: 51,587,783 V785E probably benign Het
Arhgef10 A T 8: 14,954,446 R399S probably damaging Het
Arhgef40 A G 14: 51,984,995 probably benign Het
Armc3 G T 2: 19,288,909 V504L probably benign Het
Asb10 T A 5: 24,533,835 Y408F probably benign Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccdc112 T C 18: 46,293,462 I131M probably damaging Het
Chrnb3 T A 8: 27,394,560 S442T unknown Het
Cit G A 5: 115,908,727 V400M probably benign Het
Copg1 T C 6: 87,909,721 F772L probably damaging Het
Cts3 T A 13: 61,566,766 I242F probably damaging Het
Dock1 T A 7: 134,990,629 probably benign Het
Dock1 T A 7: 135,168,403 D1797E probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fam171a2 T C 11: 102,438,610 K441R possibly damaging Het
H2-DMa A G 17: 34,137,285 E87G probably benign Het
Has2 T A 15: 56,669,945 M225L probably benign Het
Hnrnpll A G 17: 80,034,105 S502P probably damaging Het
Hnrnpul1 G T 7: 25,748,343 F185L possibly damaging Het
Hoxd11 G A 2: 74,682,376 probably benign Het
Mast4 T C 13: 102,737,676 E1728G possibly damaging Het
Minpp1 T A 19: 32,493,903 F284I probably damaging Het
Moxd1 A G 10: 24,301,612 S609G unknown Het
Myh1 A C 11: 67,215,251 M1231L probably benign Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1153 A T 2: 87,896,973 Y258F probably damaging Het
Olfr1178 A G 2: 88,391,504 T86A probably benign Het
Olfr1258 A T 2: 89,930,349 N180I probably benign Het
Olfr387-ps1 T C 11: 73,664,939 I110T probably benign Het
Olfr476 A G 7: 107,967,405 T3A probably benign Het
Olfr775 A C 10: 129,251,046 T171P possibly damaging Het
Pln A T 10: 53,343,897 I12F unknown Het
Pomt2 G A 12: 87,129,006 A388V probably damaging Het
Rbl2 T A 8: 91,096,869 probably null Het
Rnpep T C 1: 135,266,920 Y459C probably damaging Het
Slc23a4 T C 6: 34,948,401 T498A probably damaging Het
Slc2a4 A T 11: 69,945,010 L338M possibly damaging Het
Smco2 C A 6: 146,866,785 Q221K probably benign Het
Snx20 G T 8: 88,627,645 C152* probably null Het
Spata16 T C 3: 26,840,720 L306P probably damaging Het
Spata20 A T 11: 94,482,239 F520L probably benign Het
Sptbn1 A T 11: 30,101,616 D2290E probably damaging Het
Tnfrsf11b G A 15: 54,254,109 T250I probably benign Het
Trim34a G T 7: 104,260,976 W328C probably damaging Het
Trim42 T G 9: 97,363,479 M423L probably damaging Het
Trpm4 T C 7: 45,305,451 K1055E probably damaging Het
Trpv5 T A 6: 41,674,531 K238* probably null Het
Tshr A C 12: 91,538,360 I691L probably benign Het
Vmn2r-ps117 A T 17: 18,837,862 H560L possibly damaging Het
Other mutations in Larp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Larp1b APN 3 41033440 nonsense probably null
IGL01636:Larp1b APN 3 40970478 missense probably benign 0.35
IGL01845:Larp1b APN 3 40970525 missense probably benign 0.03
IGL02192:Larp1b APN 3 40967494 missense probably benign 0.01
IGL03372:Larp1b APN 3 41024527 missense possibly damaging 0.79
R0396:Larp1b UTSW 3 40970561 missense probably damaging 1.00
R0512:Larp1b UTSW 3 40970034 missense probably benign 0.00
R0975:Larp1b UTSW 3 40970490 missense probably damaging 0.99
R1119:Larp1b UTSW 3 41033528 missense possibly damaging 0.87
R1337:Larp1b UTSW 3 41033402 missense probably damaging 1.00
R1460:Larp1b UTSW 3 40962218 missense probably benign
R1565:Larp1b UTSW 3 40972384 missense probably damaging 1.00
R1589:Larp1b UTSW 3 41033474 missense probably damaging 1.00
R1640:Larp1b UTSW 3 41034072 start codon destroyed probably null 0.04
R1899:Larp1b UTSW 3 40964084 missense probably benign 0.04
R2133:Larp1b UTSW 3 40970535 missense possibly damaging 0.69
R3054:Larp1b UTSW 3 40964100 missense probably benign 0.10
R4621:Larp1b UTSW 3 40963989 missense possibly damaging 0.71
R4818:Larp1b UTSW 3 40970570 missense probably damaging 1.00
R5023:Larp1b UTSW 3 41033985 missense possibly damaging 0.88
R5166:Larp1b UTSW 3 40964052 nonsense probably null
R5357:Larp1b UTSW 3 41024515 missense probably benign 0.04
R5364:Larp1b UTSW 3 40977223 missense probably damaging 0.99
R5492:Larp1b UTSW 3 40969899 missense probably damaging 0.99
R5495:Larp1b UTSW 3 41035822 missense probably damaging 1.00
R7070:Larp1b UTSW 3 40976651 missense probably damaging 1.00
R7293:Larp1b UTSW 3 40985444 missense
R7615:Larp1b UTSW 3 41033534 missense possibly damaging 0.79
R7615:Larp1b UTSW 3 41035816 missense probably benign 0.01
R7717:Larp1b UTSW 3 40972444 missense probably damaging 0.97
R8282:Larp1b UTSW 3 41036810 missense probably damaging 0.99
R8429:Larp1b UTSW 3 40977227 makesense probably null
R8458:Larp1b UTSW 3 40976560 missense probably benign 0.00
X0021:Larp1b UTSW 3 40967494 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTGCAAGCCTTTCATACTTG -3'
(R):5'- CAAGTTTCTCTTGGAGTTCACAATTCC -3'

Sequencing Primer
(F):5'- TCATACTTGAAAACCATGGAAAGG -3'
(R):5'- GTTCACAATTCCACTTTCTAAAACC -3'
Posted On2020-01-23