Incidental Mutation 'R8060:Copg1'
ID 619642
Institutional Source Beutler Lab
Gene Symbol Copg1
Ensembl Gene ENSMUSG00000030058
Gene Name coatomer protein complex, subunit gamma 1
Synonyms D6Ertd71e, Copg, D6Wsu16e
MMRRC Submission
Accession Numbers

Genbank: NM_017477, NM_201244; MGI: 1858696

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R8060 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 87887814-87913595 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87909721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 772 (F772L)
Ref Sequence ENSEMBL: ENSMUSP00000109237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032141] [ENSMUST00000113606] [ENSMUST00000113607] [ENSMUST00000204232]
AlphaFold Q9QZE5
Predicted Effect probably benign
Transcript: ENSMUST00000032141
SMART Domains Protein: ENSMUSP00000032141
Gene: ENSMUSG00000030060

DomainStartEndE-ValueType
Pfam:SRAP 1 262 4.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113606
SMART Domains Protein: ENSMUSP00000109236
Gene: ENSMUSG00000030060

DomainStartEndE-ValueType
Pfam:DUF159 1 263 9.4e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113607
AA Change: F772L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109237
Gene: ENSMUSG00000030058
AA Change: F772L

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 4.1e-135 PFAM
Pfam:COP-gamma_platf 611 759 7.6e-64 PFAM
Pfam:Coatomer_g_Cpla 761 873 1.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204232
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
Allele List at MGI

All alleles(58) : Targeted, other(2) Gene trapped(56)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc A T 7: 97,575,648 Y2* probably null Het
Ano5 T A 7: 51,587,783 V785E probably benign Het
Arhgef10 A T 8: 14,954,446 R399S probably damaging Het
Arhgef40 A G 14: 51,984,995 probably benign Het
Armc3 G T 2: 19,288,909 V504L probably benign Het
Asb10 T A 5: 24,533,835 Y408F probably benign Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccdc112 T C 18: 46,293,462 I131M probably damaging Het
Chrnb3 T A 8: 27,394,560 S442T unknown Het
Cit G A 5: 115,908,727 V400M probably benign Het
Cts3 T A 13: 61,566,766 I242F probably damaging Het
Dock1 T A 7: 134,990,629 probably benign Het
Dock1 T A 7: 135,168,403 D1797E probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fam171a2 T C 11: 102,438,610 K441R possibly damaging Het
H2-DMa A G 17: 34,137,285 E87G probably benign Het
Has2 T A 15: 56,669,945 M225L probably benign Het
Hnrnpll A G 17: 80,034,105 S502P probably damaging Het
Hnrnpul1 G T 7: 25,748,343 F185L possibly damaging Het
Hoxd11 G A 2: 74,682,376 probably benign Het
Larp1b T C 3: 40,985,402 V330A Het
Mast4 T C 13: 102,737,676 E1728G possibly damaging Het
Minpp1 T A 19: 32,493,903 F284I probably damaging Het
Moxd1 A G 10: 24,301,612 S609G unknown Het
Myh1 A C 11: 67,215,251 M1231L probably benign Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1153 A T 2: 87,896,973 Y258F probably damaging Het
Olfr1178 A G 2: 88,391,504 T86A probably benign Het
Olfr1258 A T 2: 89,930,349 N180I probably benign Het
Olfr387-ps1 T C 11: 73,664,939 I110T probably benign Het
Olfr476 A G 7: 107,967,405 T3A probably benign Het
Olfr775 A C 10: 129,251,046 T171P possibly damaging Het
Pln A T 10: 53,343,897 I12F unknown Het
Pomt2 G A 12: 87,129,006 A388V probably damaging Het
Rbl2 T A 8: 91,096,869 probably null Het
Rnpep T C 1: 135,266,920 Y459C probably damaging Het
Slc23a4 T C 6: 34,948,401 T498A probably damaging Het
Slc2a4 A T 11: 69,945,010 L338M possibly damaging Het
Smco2 C A 6: 146,866,785 Q221K probably benign Het
Snx20 G T 8: 88,627,645 C152* probably null Het
Spata16 T C 3: 26,840,720 L306P probably damaging Het
Spata20 A T 11: 94,482,239 F520L probably benign Het
Sptbn1 A T 11: 30,101,616 D2290E probably damaging Het
Tnfrsf11b G A 15: 54,254,109 T250I probably benign Het
Trim34a G T 7: 104,260,976 W328C probably damaging Het
Trim42 T G 9: 97,363,479 M423L probably damaging Het
Trpm4 T C 7: 45,305,451 K1055E probably damaging Het
Trpv5 T A 6: 41,674,531 K238* probably null Het
Tshr A C 12: 91,538,360 I691L probably benign Het
Vmn2r-ps117 A T 17: 18,837,862 H560L possibly damaging Het
Other mutations in Copg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Copg1 APN 6 87902370 missense possibly damaging 0.94
IGL00816:Copg1 APN 6 87893898 missense possibly damaging 0.95
IGL02087:Copg1 APN 6 87902210 missense possibly damaging 0.68
R0194:Copg1 UTSW 6 87904197 splice site probably benign
R0448:Copg1 UTSW 6 87904926 missense probably benign
R0576:Copg1 UTSW 6 87897963 missense probably damaging 1.00
R0701:Copg1 UTSW 6 87894107 nonsense probably null
R1251:Copg1 UTSW 6 87890007 nonsense probably null
R1707:Copg1 UTSW 6 87905210 missense probably benign
R1845:Copg1 UTSW 6 87893818 missense probably damaging 1.00
R3500:Copg1 UTSW 6 87895923 splice site probably benign
R3952:Copg1 UTSW 6 87905216 missense probably benign
R4283:Copg1 UTSW 6 87908545 missense probably damaging 1.00
R4515:Copg1 UTSW 6 87907546 intron probably benign
R4715:Copg1 UTSW 6 87912286 nonsense probably null
R4797:Copg1 UTSW 6 87903468 intron probably benign
R4864:Copg1 UTSW 6 87889696 missense probably damaging 1.00
R4947:Copg1 UTSW 6 87903473 splice site probably benign
R5265:Copg1 UTSW 6 87892270 missense probably damaging 0.98
R5288:Copg1 UTSW 6 87890207 missense possibly damaging 0.90
R5386:Copg1 UTSW 6 87890207 missense possibly damaging 0.90
R5511:Copg1 UTSW 6 87912294 missense probably damaging 0.99
R5670:Copg1 UTSW 6 87912235 missense probably damaging 1.00
R5887:Copg1 UTSW 6 87902297 missense probably damaging 1.00
R7014:Copg1 UTSW 6 87902340 missense probably damaging 1.00
R7021:Copg1 UTSW 6 87894105 missense possibly damaging 0.94
R7380:Copg1 UTSW 6 87893842 missense probably damaging 0.98
R7392:Copg1 UTSW 6 87890275 missense probably benign 0.01
R7629:Copg1 UTSW 6 87894169 missense possibly damaging 0.90
R7704:Copg1 UTSW 6 87907958 missense probably benign 0.13
R8184:Copg1 UTSW 6 87890014 missense probably damaging 1.00
R8683:Copg1 UTSW 6 87892655 missense probably damaging 1.00
R9320:Copg1 UTSW 6 87910090 missense possibly damaging 0.65
R9433:Copg1 UTSW 6 87903496 missense possibly damaging 0.95
R9564:Copg1 UTSW 6 87892701 missense probably damaging 0.97
R9660:Copg1 UTSW 6 87902243 missense probably damaging 0.96
R9709:Copg1 UTSW 6 87891975 missense probably benign 0.22
R9728:Copg1 UTSW 6 87902243 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGCTCTGTGTCCTGAAGCC -3'
(R):5'- GTCCCAAGCTAGGTATCCCTTAAG -3'

Sequencing Primer
(F):5'- TGTGTCCTGAAGCCCACCATG -3'
(R):5'- AAGCTAGGTATCCCTTAAGGCTCTG -3'
Posted On 2020-01-23