Incidental Mutation 'R8060:Myh1'
ID619661
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Namemyosin, heavy polypeptide 1, skeletal muscle, adult
SynonymsA530084A17Rik, Myhsf2, Myhs-f2, Myhs-f, IId/x, IId, myosin heavy chain 2X, MYHC-IIX, MyHC-IId/x
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8060 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67200052-67224575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67215251 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1231 (M1231L)
Ref Sequence ENSEMBL: ENSMUSP00000117569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000075734] [ENSMUST00000124516]
Predicted Effect probably benign
Transcript: ENSMUST00000018637
AA Change: M1231L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328
AA Change: M1231L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075734
AA Change: M1231L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328
AA Change: M1231L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124516
AA Change: M1231L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328
AA Change: M1231L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc A T 7: 97,575,648 Y2* probably null Het
Ano5 T A 7: 51,587,783 V785E probably benign Het
Arhgef10 A T 8: 14,954,446 R399S probably damaging Het
Arhgef40 A G 14: 51,984,995 probably benign Het
Armc3 G T 2: 19,288,909 V504L probably benign Het
Asb10 T A 5: 24,533,835 Y408F probably benign Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccdc112 T C 18: 46,293,462 I131M probably damaging Het
Chrnb3 T A 8: 27,394,560 S442T unknown Het
Cit G A 5: 115,908,727 V400M probably benign Het
Copg1 T C 6: 87,909,721 F772L probably damaging Het
Cts3 T A 13: 61,566,766 I242F probably damaging Het
Dock1 T A 7: 134,990,629 probably benign Het
Dock1 T A 7: 135,168,403 D1797E probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fam171a2 T C 11: 102,438,610 K441R possibly damaging Het
H2-DMa A G 17: 34,137,285 E87G probably benign Het
Has2 T A 15: 56,669,945 M225L probably benign Het
Hnrnpll A G 17: 80,034,105 S502P probably damaging Het
Hnrnpul1 G T 7: 25,748,343 F185L possibly damaging Het
Hoxd11 G A 2: 74,682,376 probably benign Het
Larp1b T C 3: 40,985,402 V330A Het
Mast4 T C 13: 102,737,676 E1728G possibly damaging Het
Minpp1 T A 19: 32,493,903 F284I probably damaging Het
Moxd1 A G 10: 24,301,612 S609G unknown Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1153 A T 2: 87,896,973 Y258F probably damaging Het
Olfr1178 A G 2: 88,391,504 T86A probably benign Het
Olfr1258 A T 2: 89,930,349 N180I probably benign Het
Olfr387-ps1 T C 11: 73,664,939 I110T probably benign Het
Olfr476 A G 7: 107,967,405 T3A probably benign Het
Olfr775 A C 10: 129,251,046 T171P possibly damaging Het
Pln A T 10: 53,343,897 I12F unknown Het
Pomt2 G A 12: 87,129,006 A388V probably damaging Het
Rbl2 T A 8: 91,096,869 probably null Het
Rnpep T C 1: 135,266,920 Y459C probably damaging Het
Slc23a4 T C 6: 34,948,401 T498A probably damaging Het
Slc2a4 A T 11: 69,945,010 L338M possibly damaging Het
Smco2 C A 6: 146,866,785 Q221K probably benign Het
Snx20 G T 8: 88,627,645 C152* probably null Het
Spata16 T C 3: 26,840,720 L306P probably damaging Het
Spata20 A T 11: 94,482,239 F520L probably benign Het
Sptbn1 A T 11: 30,101,616 D2290E probably damaging Het
Tnfrsf11b G A 15: 54,254,109 T250I probably benign Het
Trim34a G T 7: 104,260,976 W328C probably damaging Het
Trim42 T G 9: 97,363,479 M423L probably damaging Het
Trpm4 T C 7: 45,305,451 K1055E probably damaging Het
Trpv5 T A 6: 41,674,531 K238* probably null Het
Tshr A C 12: 91,538,360 I691L probably benign Het
Vmn2r-ps117 A T 17: 18,837,862 H560L possibly damaging Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67220865 missense probably damaging 0.99
IGL00514:Myh1 APN 11 67219784 missense probably damaging 1.00
IGL00851:Myh1 APN 11 67217910 missense probably damaging 0.96
IGL01061:Myh1 APN 11 67217862 missense probably benign 0.05
IGL01113:Myh1 APN 11 67202180 missense probably benign 0.00
IGL01125:Myh1 APN 11 67220660 missense probably benign
IGL01391:Myh1 APN 11 67217863 missense probably benign 0.00
IGL01392:Myh1 APN 11 67221301 missense probably benign 0.20
IGL01404:Myh1 APN 11 67222151 missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67211412 missense probably damaging 1.00
IGL01739:Myh1 APN 11 67214528 missense probably damaging 0.99
IGL01759:Myh1 APN 11 67219906 missense probably damaging 1.00
IGL01922:Myh1 APN 11 67210466 critical splice donor site probably null
IGL01952:Myh1 APN 11 67220392 splice site probably null
IGL02007:Myh1 APN 11 67220556 missense probably benign 0.03
IGL02028:Myh1 APN 11 67210615 missense probably damaging 1.00
IGL02245:Myh1 APN 11 67211487 missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67206262 unclassified probably benign
IGL02942:Myh1 APN 11 67202482 missense probably damaging 1.00
IGL02967:Myh1 APN 11 67209070 missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67206387 missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67206525 missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67211502 missense probably benign 0.01
convincing UTSW 11 67202539 missense probably damaging 1.00
muscle UTSW 11 67206048 nonsense probably null
Persuasive UTSW 11 67209064 missense possibly damaging 0.90
G1patch:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R0041:Myh1 UTSW 11 67209078 missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67213411 missense probably damaging 1.00
R0081:Myh1 UTSW 11 67215857 missense probably benign
R0317:Myh1 UTSW 11 67217512 missense probably damaging 1.00
R0465:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67220619 missense probably damaging 1.00
R0731:Myh1 UTSW 11 67202533 missense probably damaging 0.98
R0964:Myh1 UTSW 11 67205925 missense probably benign
R0964:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R1427:Myh1 UTSW 11 67219747 missense probably damaging 0.99
R1429:Myh1 UTSW 11 67217910 missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67205499 unclassified probably benign
R1562:Myh1 UTSW 11 67211370 missense probably benign 0.04
R1727:Myh1 UTSW 11 67210466 critical splice donor site probably benign
R1796:Myh1 UTSW 11 67224357 missense probably benign 0.00
R1808:Myh1 UTSW 11 67211474 nonsense probably null
R1836:Myh1 UTSW 11 67204822 missense probably damaging 0.98
R1848:Myh1 UTSW 11 67213630 missense probably benign 0.10
R1851:Myh1 UTSW 11 67204398 missense probably damaging 1.00
R1925:Myh1 UTSW 11 67211170 missense probably benign 0.01
R1967:Myh1 UTSW 11 67213447 missense probably benign 0.08
R1999:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2067:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2189:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R2352:Myh1 UTSW 11 67220537 missense probably benign 0.00
R2436:Myh1 UTSW 11 67213271 missense probably benign 0.04
R2483:Myh1 UTSW 11 67211226 missense probably benign
R2508:Myh1 UTSW 11 67213598 missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2511:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2908:Myh1 UTSW 11 67220696 nonsense probably null
R2966:Myh1 UTSW 11 67214584 missense probably damaging 1.00
R3829:Myh1 UTSW 11 67205597 missense probably benign 0.01
R4106:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4108:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4457:Myh1 UTSW 11 67220615 missense probably benign 0.42
R4629:Myh1 UTSW 11 67209293 missense probably benign 0.01
R4981:Myh1 UTSW 11 67224474 utr 3 prime probably benign
R5032:Myh1 UTSW 11 67206048 nonsense probably null
R5239:Myh1 UTSW 11 67215225 missense probably benign 0.19
R5241:Myh1 UTSW 11 67204449 missense probably benign
R5303:Myh1 UTSW 11 67202017 missense probably benign 0.09
R5666:Myh1 UTSW 11 67221352 missense probably benign 0.30
R5717:Myh1 UTSW 11 67208956 missense probably benign
R5761:Myh1 UTSW 11 67219252 missense probably damaging 0.98
R5870:Myh1 UTSW 11 67201979 missense possibly damaging 0.70
R6077:Myh1 UTSW 11 67211447 missense probably damaging 1.00
R6089:Myh1 UTSW 11 67202167 splice site probably null
R6089:Myh1 UTSW 11 67220787 splice site probably null
R6197:Myh1 UTSW 11 67220967 missense probably benign 0.01
R6460:Myh1 UTSW 11 67221376 missense probably benign
R6627:Myh1 UTSW 11 67215009 missense probably damaging 1.00
R6634:Myh1 UTSW 11 67209064 missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R6784:Myh1 UTSW 11 67214570 missense probably damaging 0.99
R6813:Myh1 UTSW 11 67220460 missense probably benign 0.34
R6866:Myh1 UTSW 11 67224393 missense probably damaging 0.99
R6997:Myh1 UTSW 11 67220637 missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67220421 missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67202586 missense probably benign
R7185:Myh1 UTSW 11 67207459 missense probably damaging 1.00
R7194:Myh1 UTSW 11 67211357 missense probably benign
R7283:Myh1 UTSW 11 67201844 critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67220609 missense probably benign 0.00
R7348:Myh1 UTSW 11 67202539 missense probably damaging 1.00
R7369:Myh1 UTSW 11 67220698 missense probably damaging 1.00
R7375:Myh1 UTSW 11 67210428 missense probably damaging 1.00
R7384:Myh1 UTSW 11 67224375 missense possibly damaging 0.46
R7387:Myh1 UTSW 11 67208889 missense probably benign 0.14
R7424:Myh1 UTSW 11 67213663 missense probably damaging 1.00
R7430:Myh1 UTSW 11 67205567 nonsense probably null
R7443:Myh1 UTSW 11 67220505 missense probably benign
R7447:Myh1 UTSW 11 67219180 missense probably benign 0.01
R7509:Myh1 UTSW 11 67210461 missense probably benign 0.40
R7583:Myh1 UTSW 11 67220913 missense probably benign 0.00
R7611:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67215875 missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67215922 missense probably benign 0.00
R8029:Myh1 UTSW 11 67211240 critical splice donor site probably null
R8042:Myh1 UTSW 11 67206603 missense probably damaging 1.00
R8080:Myh1 UTSW 11 67211402 missense probably benign 0.10
R8117:Myh1 UTSW 11 67222205 missense probably damaging 1.00
R8171:Myh1 UTSW 11 67202572 missense probably damaging 1.00
R8183:Myh1 UTSW 11 67202006 missense possibly damaging 0.50
R8397:Myh1 UTSW 11 67221639 missense probably damaging 0.97
R8545:Myh1 UTSW 11 67202201 missense probably benign 0.00
R8807:Myh1 UTSW 11 67220528 missense probably benign 0.02
R8812:Myh1 UTSW 11 67209141 missense probably benign 0.00
R8855:Myh1 UTSW 11 67211421 missense probably damaging 1.00
R8906:Myh1 UTSW 11 67205913 missense probably benign 0.02
R8959:Myh1 UTSW 11 67211502 missense probably benign
X0062:Myh1 UTSW 11 67207541 missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67206318 missense probably damaging 1.00
Z1187:Myh1 UTSW 11 67204446 missense probably benign
Z1188:Myh1 UTSW 11 67204446 missense probably benign
Z1190:Myh1 UTSW 11 67204446 missense probably benign
Z1191:Myh1 UTSW 11 67204446 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGCCCAAATCGAGATGAAC -3'
(R):5'- AGGAGCTCTGTTTTCGCTCC -3'

Sequencing Primer
(F):5'- CAGCCCAAATCGAGATGAACAAGAAG -3'
(R):5'- ATGGCTATTCTCACTTAGGGTG -3'
Posted On2020-01-23