Incidental Mutation 'R8060:Vmn2r-ps117'
ID619673
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps117
Ensembl Gene ENSMUSG00000093531
Gene Namevomeronasal 2, receptor, pseudogene 117
SynonymsEG665303
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R8060 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location18810835-18838900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18837862 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 560 (H560L)
Ref Sequence ENSEMBL: ENSMUSP00000156026 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000176899
AA Change: H560L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc A T 7: 97,575,648 Y2* probably null Het
Ano5 T A 7: 51,587,783 V785E probably benign Het
Arhgef10 A T 8: 14,954,446 R399S probably damaging Het
Arhgef40 A G 14: 51,984,995 probably benign Het
Armc3 G T 2: 19,288,909 V504L probably benign Het
Asb10 T A 5: 24,533,835 Y408F probably benign Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccdc112 T C 18: 46,293,462 I131M probably damaging Het
Chrnb3 T A 8: 27,394,560 S442T unknown Het
Cit G A 5: 115,908,727 V400M probably benign Het
Copg1 T C 6: 87,909,721 F772L probably damaging Het
Cts3 T A 13: 61,566,766 I242F probably damaging Het
Dock1 T A 7: 135,168,403 D1797E probably benign Het
Dock1 T A 7: 134,990,629 probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fam171a2 T C 11: 102,438,610 K441R possibly damaging Het
H2-DMa A G 17: 34,137,285 E87G probably benign Het
Has2 T A 15: 56,669,945 M225L probably benign Het
Hnrnpll A G 17: 80,034,105 S502P probably damaging Het
Hnrnpul1 G T 7: 25,748,343 F185L possibly damaging Het
Hoxd11 G A 2: 74,682,376 probably benign Het
Larp1b T C 3: 40,985,402 V330A Het
Mast4 T C 13: 102,737,676 E1728G possibly damaging Het
Minpp1 T A 19: 32,493,903 F284I probably damaging Het
Moxd1 A G 10: 24,301,612 S609G unknown Het
Myh1 A C 11: 67,215,251 M1231L probably benign Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1153 A T 2: 87,896,973 Y258F probably damaging Het
Olfr1178 A G 2: 88,391,504 T86A probably benign Het
Olfr1258 A T 2: 89,930,349 N180I probably benign Het
Olfr387-ps1 T C 11: 73,664,939 I110T probably benign Het
Olfr476 A G 7: 107,967,405 T3A probably benign Het
Olfr775 A C 10: 129,251,046 T171P possibly damaging Het
Pln A T 10: 53,343,897 I12F unknown Het
Pomt2 G A 12: 87,129,006 A388V probably damaging Het
Rbl2 T A 8: 91,096,869 probably null Het
Rnpep T C 1: 135,266,920 Y459C probably damaging Het
Slc23a4 T C 6: 34,948,401 T498A probably damaging Het
Slc2a4 A T 11: 69,945,010 L338M possibly damaging Het
Smco2 C A 6: 146,866,785 Q221K probably benign Het
Snx20 G T 8: 88,627,645 C152* probably null Het
Spata16 T C 3: 26,840,720 L306P probably damaging Het
Spata20 A T 11: 94,482,239 F520L probably benign Het
Sptbn1 A T 11: 30,101,616 D2290E probably damaging Het
Tnfrsf11b G A 15: 54,254,109 T250I probably benign Het
Trim34a G T 7: 104,260,976 W328C probably damaging Het
Trim42 T G 9: 97,363,479 M423L probably damaging Het
Trpm4 T C 7: 45,305,451 K1055E probably damaging Het
Trpv5 T A 6: 41,674,531 K238* probably null Het
Tshr A C 12: 91,538,360 I691L probably benign Het
Other mutations in Vmn2r-ps117
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6903:Vmn2r-ps117 UTSW 17 18838290 missense possibly damaging 0.94
R6912:Vmn2r-ps117 UTSW 17 18827202 missense probably damaging 1.00
R6934:Vmn2r-ps117 UTSW 17 18824705 nonsense probably null
R6953:Vmn2r-ps117 UTSW 17 18824833 missense probably benign
R6974:Vmn2r-ps117 UTSW 17 18838233 missense probably benign 0.15
R7373:Vmn2r-ps117 UTSW 17 18824686 missense probably benign
R7630:Vmn2r-ps117 UTSW 17 18824647 missense probably benign 0.01
R7776:Vmn2r-ps117 UTSW 17 18823672 missense probably damaging 0.96
R8126:Vmn2r-ps117 UTSW 17 18822552 missense probably benign 0.00
Z1177:Vmn2r-ps117 UTSW 17 18838076 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCATCAAATCCTATGGTATGTGAAC -3'
(R):5'- TGCCTTGACAATAGGAGTGTC -3'

Sequencing Primer
(F):5'- TGGTATGTGAACATAAATATGGAACG -3'
(R):5'- ACAATAGGAGTGTCTCTGTGCTTCAC -3'
Posted On2020-01-23