Incidental Mutation 'R8060:H2-DMa'
ID 619674
Institutional Source Beutler Lab
Gene Symbol H2-DMa
Ensembl Gene ENSMUSG00000037649
Gene Name histocompatibility 2, class II, locus DMa
Synonyms H2-M alpha, H2-Ma, H-2Ma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock # R8060 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34135182-34139101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34137285 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 87 (E87G)
Ref Sequence ENSEMBL: ENSMUSP00000037088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042121]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042121
AA Change: E87G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000037088
Gene: ENSMUSG00000037649
AA Change: E87G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_alpha 42 123 2.83e-19 SMART
IGc1 142 212 5.82e-23 SMART
transmembrane domain 231 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired antigen presenting cell function, poor IgG responses to T-dependent antigens, reduced numbers of mature CD4+ T cells, and increased susceptibility to Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc A T 7: 97,575,648 Y2* probably null Het
Ano5 T A 7: 51,587,783 V785E probably benign Het
Arhgef10 A T 8: 14,954,446 R399S probably damaging Het
Arhgef40 A G 14: 51,984,995 probably benign Het
Armc3 G T 2: 19,288,909 V504L probably benign Het
Asb10 T A 5: 24,533,835 Y408F probably benign Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccdc112 T C 18: 46,293,462 I131M probably damaging Het
Chrnb3 T A 8: 27,394,560 S442T unknown Het
Cit G A 5: 115,908,727 V400M probably benign Het
Copg1 T C 6: 87,909,721 F772L probably damaging Het
Cts3 T A 13: 61,566,766 I242F probably damaging Het
Dock1 T A 7: 135,168,403 D1797E probably benign Het
Dock1 T A 7: 134,990,629 probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fam171a2 T C 11: 102,438,610 K441R possibly damaging Het
Has2 T A 15: 56,669,945 M225L probably benign Het
Hnrnpll A G 17: 80,034,105 S502P probably damaging Het
Hnrnpul1 G T 7: 25,748,343 F185L possibly damaging Het
Hoxd11 G A 2: 74,682,376 probably benign Het
Larp1b T C 3: 40,985,402 V330A Het
Mast4 T C 13: 102,737,676 E1728G possibly damaging Het
Minpp1 T A 19: 32,493,903 F284I probably damaging Het
Moxd1 A G 10: 24,301,612 S609G unknown Het
Myh1 A C 11: 67,215,251 M1231L probably benign Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1153 A T 2: 87,896,973 Y258F probably damaging Het
Olfr1178 A G 2: 88,391,504 T86A probably benign Het
Olfr1258 A T 2: 89,930,349 N180I probably benign Het
Olfr387-ps1 T C 11: 73,664,939 I110T probably benign Het
Olfr476 A G 7: 107,967,405 T3A probably benign Het
Olfr775 A C 10: 129,251,046 T171P possibly damaging Het
Pln A T 10: 53,343,897 I12F unknown Het
Pomt2 G A 12: 87,129,006 A388V probably damaging Het
Rbl2 T A 8: 91,096,869 probably null Het
Rnpep T C 1: 135,266,920 Y459C probably damaging Het
Slc23a4 T C 6: 34,948,401 T498A probably damaging Het
Slc2a4 A T 11: 69,945,010 L338M possibly damaging Het
Smco2 C A 6: 146,866,785 Q221K probably benign Het
Snx20 G T 8: 88,627,645 C152* probably null Het
Spata16 T C 3: 26,840,720 L306P probably damaging Het
Spata20 A T 11: 94,482,239 F520L probably benign Het
Sptbn1 A T 11: 30,101,616 D2290E probably damaging Het
Tnfrsf11b G A 15: 54,254,109 T250I probably benign Het
Trim34a G T 7: 104,260,976 W328C probably damaging Het
Trim42 T G 9: 97,363,479 M423L probably damaging Het
Trpm4 T C 7: 45,305,451 K1055E probably damaging Het
Trpv5 T A 6: 41,674,531 K238* probably null Het
Tshr A C 12: 91,538,360 I691L probably benign Het
Vmn2r-ps117 A T 17: 18,837,862 H560L possibly damaging Het
Other mutations in H2-DMa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03286:H2-DMa APN 17 34137109 splice site probably null
R0422:H2-DMa UTSW 17 34137947 missense probably damaging 1.00
R0620:H2-DMa UTSW 17 34137960 missense probably damaging 0.96
R1240:H2-DMa UTSW 17 34138406 critical splice acceptor site probably null
R1483:H2-DMa UTSW 17 34135750 missense possibly damaging 0.61
R1656:H2-DMa UTSW 17 34138142 missense possibly damaging 0.92
R1657:H2-DMa UTSW 17 34137399 critical splice donor site probably null
R1696:H2-DMa UTSW 17 34138413 missense probably benign 0.44
R2884:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R2886:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R5024:H2-DMa UTSW 17 34138487 missense possibly damaging 0.77
R5236:H2-DMa UTSW 17 34137939 missense probably damaging 1.00
R5632:H2-DMa UTSW 17 34138001 missense probably benign 0.14
R6358:H2-DMa UTSW 17 34137984 missense probably damaging 1.00
R6423:H2-DMa UTSW 17 34137196 missense probably benign 0.05
R7033:H2-DMa UTSW 17 34136997 splice site probably null
R7387:H2-DMa UTSW 17 34138127 missense probably damaging 1.00
R8504:H2-DMa UTSW 17 34138442 missense probably damaging 1.00
R8813:H2-DMa UTSW 17 34135760 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAGCCCTGAACTCACTG -3'
(R):5'- ATTTCGATGCCTTCAGCTGC -3'

Sequencing Primer
(F):5'- GTCTCTTTGCAGCATCTACACCAG -3'
(R):5'- CTGTAGCTGACAAGAGAAGTGTTGAC -3'
Posted On 2020-01-23