Incidental Mutation 'R8060:Hnrnpll'
ID 619675
Institutional Source Beutler Lab
Gene Symbol Hnrnpll
Ensembl Gene ENSMUSG00000024095
Gene Name heterogeneous nuclear ribonucleoprotein L-like
Synonyms 2510028H02Rik, Hnrpll, 2810036L13Rik
MMRRC Submission
Accession Numbers

Genbank: NM_144802; MGI: 1919942
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock # R8060 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 80029487-80062334 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80034105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 502 (S502P)
Ref Sequence ENSEMBL: ENSMUSP00000139372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]
AlphaFold Q921F4
Predicted Effect probably damaging
Transcript: ENSMUST00000061331
AA Change: S502P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: S502P

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184297
SMART Domains Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184635
AA Change: S502P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: S502P

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Meta Mutation Damage Score 0.3872 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4+ T cell counts are lower, with a reduction of na�ve CD44lo T cells occurring as mice age. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc A T 7: 97,575,648 Y2* probably null Het
Ano5 T A 7: 51,587,783 V785E probably benign Het
Arhgef10 A T 8: 14,954,446 R399S probably damaging Het
Arhgef40 A G 14: 51,984,995 probably benign Het
Armc3 G T 2: 19,288,909 V504L probably benign Het
Asb10 T A 5: 24,533,835 Y408F probably benign Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccdc112 T C 18: 46,293,462 I131M probably damaging Het
Chrnb3 T A 8: 27,394,560 S442T unknown Het
Cit G A 5: 115,908,727 V400M probably benign Het
Copg1 T C 6: 87,909,721 F772L probably damaging Het
Cts3 T A 13: 61,566,766 I242F probably damaging Het
Dock1 T A 7: 135,168,403 D1797E probably benign Het
Dock1 T A 7: 134,990,629 probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fam171a2 T C 11: 102,438,610 K441R possibly damaging Het
H2-DMa A G 17: 34,137,285 E87G probably benign Het
Has2 T A 15: 56,669,945 M225L probably benign Het
Hnrnpul1 G T 7: 25,748,343 F185L possibly damaging Het
Hoxd11 G A 2: 74,682,376 probably benign Het
Larp1b T C 3: 40,985,402 V330A Het
Mast4 T C 13: 102,737,676 E1728G possibly damaging Het
Minpp1 T A 19: 32,493,903 F284I probably damaging Het
Moxd1 A G 10: 24,301,612 S609G unknown Het
Myh1 A C 11: 67,215,251 M1231L probably benign Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1153 A T 2: 87,896,973 Y258F probably damaging Het
Olfr1178 A G 2: 88,391,504 T86A probably benign Het
Olfr1258 A T 2: 89,930,349 N180I probably benign Het
Olfr387-ps1 T C 11: 73,664,939 I110T probably benign Het
Olfr476 A G 7: 107,967,405 T3A probably benign Het
Olfr775 A C 10: 129,251,046 T171P possibly damaging Het
Pln A T 10: 53,343,897 I12F unknown Het
Pomt2 G A 12: 87,129,006 A388V probably damaging Het
Rbl2 T A 8: 91,096,869 probably null Het
Rnpep T C 1: 135,266,920 Y459C probably damaging Het
Slc23a4 T C 6: 34,948,401 T498A probably damaging Het
Slc2a4 A T 11: 69,945,010 L338M possibly damaging Het
Smco2 C A 6: 146,866,785 Q221K probably benign Het
Snx20 G T 8: 88,627,645 C152* probably null Het
Spata16 T C 3: 26,840,720 L306P probably damaging Het
Spata20 A T 11: 94,482,239 F520L probably benign Het
Sptbn1 A T 11: 30,101,616 D2290E probably damaging Het
Tnfrsf11b G A 15: 54,254,109 T250I probably benign Het
Trim34a G T 7: 104,260,976 W328C probably damaging Het
Trim42 T G 9: 97,363,479 M423L probably damaging Het
Trpm4 T C 7: 45,305,451 K1055E probably damaging Het
Trpv5 T A 6: 41,674,531 K238* probably null Het
Tshr A C 12: 91,538,360 I691L probably benign Het
Vmn2r-ps117 A T 17: 18,837,862 H560L possibly damaging Het
Other mutations in Hnrnpll
AlleleSourceChrCoordTypePredicted EffectPPH Score
thunder APN 17 80053571 missense probably damaging 1.00
IGL01989:Hnrnpll APN 17 80038740 missense probably benign 0.15
IGL02093:Hnrnpll APN 17 80044504 missense probably benign 0.00
IGL02141:Hnrnpll APN 17 80050713 missense probably benign 0.02
IGL02749:Hnrnpll APN 17 80061991 start codon destroyed probably null
IGL03213:Hnrnpll APN 17 80034098 missense probably damaging 1.00
Grell UTSW 17 80034105 missense probably damaging 1.00
Lindsley UTSW 17 80049847 missense probably damaging 1.00
R0477:Hnrnpll UTSW 17 80061832 missense unknown
R1599:Hnrnpll UTSW 17 80053625 missense unknown
R1700:Hnrnpll UTSW 17 80034105 missense probably benign 0.18
R1838:Hnrnpll UTSW 17 80038623 missense probably damaging 1.00
R1907:Hnrnpll UTSW 17 80035329 critical splice donor site probably null
R1978:Hnrnpll UTSW 17 80044518 missense probably benign 0.01
R2079:Hnrnpll UTSW 17 80035377 missense probably benign 0.01
R4061:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4062:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4064:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4226:Hnrnpll UTSW 17 80049805 critical splice donor site probably null
R4625:Hnrnpll UTSW 17 80050862 nonsense probably null
R5175:Hnrnpll UTSW 17 80034070 missense possibly damaging 0.83
R5232:Hnrnpll UTSW 17 80038678 missense probably damaging 1.00
R5620:Hnrnpll UTSW 17 80038622 missense probably damaging 1.00
R5978:Hnrnpll UTSW 17 80034191 missense probably damaging 1.00
R6183:Hnrnpll UTSW 17 80049876 missense possibly damaging 0.46
R6374:Hnrnpll UTSW 17 80049874 missense possibly damaging 0.51
R7120:Hnrnpll UTSW 17 80034057 missense probably benign 0.01
R7429:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7430:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7576:Hnrnpll UTSW 17 80044514 missense possibly damaging 0.91
R8001:Hnrnpll UTSW 17 80038723 nonsense probably null
R8010:Hnrnpll UTSW 17 80061956 missense unknown
R8068:Hnrnpll UTSW 17 80050852 missense possibly damaging 0.80
R8381:Hnrnpll UTSW 17 80030491 missense probably damaging 1.00
R9378:Hnrnpll UTSW 17 80061862 missense unknown
R9488:Hnrnpll UTSW 17 80061956 missense unknown
Z1177:Hnrnpll UTSW 17 80048610 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTAGGCTCTACGTACACAAACC -3'
(R):5'- GGATAAATGGTTGCCTGCACC -3'

Sequencing Primer
(F):5'- TAGGCTCTACGTACACAAACCCAAAC -3'
(R):5'- GGTTGCCTGCACCAAATTTAAATAGC -3'
Posted On 2020-01-23