Mutagenetix > Incidental Mutations

Incidental Mutation 'R8060:Hnrnpll'

619675

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpll

Ensembl Gene

ENSMUSG00000024095

Gene Name

heterogeneous nuclear ribonucleoprotein L-like

Synonyms

2510028H02Rik, Hnrpll, 2810036L13Rik

MMRRC Submission

Accession Numbers

Genbank: NM_144802; MGI: 1919942

Is this an essential gene?

Probably essential (E-score: 0.844) question?

Stock #

R8060 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80029487-80062334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80034105 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 502 (S502P)

Ref Sequence

ENSEMBL: ENSMUSP00000139372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]

Predicted Effect

probably damaging
Transcript: ENSMUST00000061331
AA Change: S502P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: S502P

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000184297

SMART Domains

Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000184635
AA Change: S502P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: S502P

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Meta Mutation Damage Score

0.3872

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4⁺ T cell counts are lower, with a reduction of naï¿½ve CD44^lo T cells occurring as mice age. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamdc	A	T	7: 97,575,648	Y2*	probably null	Het
Ano5	T	A	7: 51,587,783	V785E	probably benign	Het
Arhgef10	A	T	8: 14,954,446	R399S	probably damaging	Het
Arhgef40	A	G	14: 51,984,995		probably benign	Het
Armc3	G	T	2: 19,288,909	V504L	probably benign	Het
Asb10	T	A	5: 24,533,835	Y408F	probably benign	Het
Catsperb	A	T	12: 101,602,766	N899I	probably damaging	Het
Ccdc112	T	C	18: 46,293,462	I131M	probably damaging	Het
Chrnb3	T	A	8: 27,394,560	S442T	unknown	Het
Cit	G	A	5: 115,908,727	V400M	probably benign	Het
Copg1	T	C	6: 87,909,721	F772L	probably damaging	Het
Cts3	T	A	13: 61,566,766	I242F	probably damaging	Het
Dock1	T	A	7: 135,168,403	D1797E	probably benign	Het
Dock1	T	A	7: 134,990,629		probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Fam171a2	T	C	11: 102,438,610	K441R	possibly damaging	Het
H2-DMa	A	G	17: 34,137,285	E87G	probably benign	Het
Has2	T	A	15: 56,669,945	M225L	probably benign	Het
Hnrnpul1	G	T	7: 25,748,343	F185L	possibly damaging	Het
Hoxd11	G	A	2: 74,682,376		probably benign	Het
Larp1b	T	C	3: 40,985,402	V330A		Het
Mast4	T	C	13: 102,737,676	E1728G	possibly damaging	Het
Minpp1	T	A	19: 32,493,903	F284I	probably damaging	Het
Moxd1	A	G	10: 24,301,612	S609G	unknown	Het
Myh1	A	C	11: 67,215,251	M1231L	probably benign	Het
Nup107	T	C	10: 117,763,769	E615G	probably damaging	Het
Olfr1153	A	T	2: 87,896,973	Y258F	probably damaging	Het
Olfr1178	A	G	2: 88,391,504	T86A	probably benign	Het
Olfr1258	A	T	2: 89,930,349	N180I	probably benign	Het
Olfr387-ps1	T	C	11: 73,664,939	I110T	probably benign	Het
Olfr476	A	G	7: 107,967,405	T3A	probably benign	Het
Olfr775	A	C	10: 129,251,046	T171P	possibly damaging	Het
Pln	A	T	10: 53,343,897	I12F	unknown	Het
Pomt2	G	A	12: 87,129,006	A388V	probably damaging	Het
Rbl2	T	A	8: 91,096,869		probably null	Het
Rnpep	T	C	1: 135,266,920	Y459C	probably damaging	Het
Slc23a4	T	C	6: 34,948,401	T498A	probably damaging	Het
Slc2a4	A	T	11: 69,945,010	L338M	possibly damaging	Het
Smco2	C	A	6: 146,866,785	Q221K	probably benign	Het
Snx20	G	T	8: 88,627,645	C152*	probably null	Het
Spata16	T	C	3: 26,840,720	L306P	probably damaging	Het
Spata20	A	T	11: 94,482,239	F520L	probably benign	Het
Sptbn1	A	T	11: 30,101,616	D2290E	probably damaging	Het
Tnfrsf11b	G	A	15: 54,254,109	T250I	probably benign	Het
Trim34a	G	T	7: 104,260,976	W328C	probably damaging	Het
Trim42	T	G	9: 97,363,479	M423L	probably damaging	Het
Trpm4	T	C	7: 45,305,451	K1055E	probably damaging	Het
Trpv5	T	A	6: 41,674,531	K238*	probably null	Het
Tshr	A	C	12: 91,538,360	I691L	probably benign	Het
Vmn2r-ps117	A	T	17: 18,837,862	H560L	possibly damaging	Het

Other mutations in Hnrnpll

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
thunder	APN	17	80053571	missense	probably damaging	1.00
IGL01989:Hnrnpll	APN	17	80038740	missense	probably benign	0.15
IGL02093:Hnrnpll	APN	17	80044504	missense	probably benign	0.00
IGL02141:Hnrnpll	APN	17	80050713	missense	probably benign	0.02
IGL02749:Hnrnpll	APN	17	80061991	start codon destroyed	probably null
IGL03213:Hnrnpll	APN	17	80034098	missense	probably damaging	1.00
Grell	UTSW	17	80034105	missense	probably damaging	1.00
Lindsley	UTSW	17	80049847	missense	probably damaging	1.00
R0477:Hnrnpll	UTSW	17	80061832	missense	unknown
R1599:Hnrnpll	UTSW	17	80053625	missense	unknown
R1700:Hnrnpll	UTSW	17	80034105	missense	probably benign	0.18
R1838:Hnrnpll	UTSW	17	80038623	missense	probably damaging	1.00
R1907:Hnrnpll	UTSW	17	80035329	critical splice donor site	probably null
R1978:Hnrnpll	UTSW	17	80044518	missense	probably benign	0.01
R2079:Hnrnpll	UTSW	17	80035377	missense	probably benign	0.01
R4061:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4062:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4064:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4226:Hnrnpll	UTSW	17	80049805	critical splice donor site	probably null
R4625:Hnrnpll	UTSW	17	80050862	nonsense	probably null
R5175:Hnrnpll	UTSW	17	80034070	missense	possibly damaging	0.83
R5232:Hnrnpll	UTSW	17	80038678	missense	probably damaging	1.00
R5620:Hnrnpll	UTSW	17	80038622	missense	probably damaging	1.00
R5978:Hnrnpll	UTSW	17	80034191	missense	probably damaging	1.00
R6183:Hnrnpll	UTSW	17	80049876	missense	possibly damaging	0.46
R6374:Hnrnpll	UTSW	17	80049874	missense	possibly damaging	0.51
R7120:Hnrnpll	UTSW	17	80034057	missense	probably benign	0.01
R7429:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7430:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7576:Hnrnpll	UTSW	17	80044514	missense	possibly damaging	0.91
R8001:Hnrnpll	UTSW	17	80038723	nonsense	probably null
R8010:Hnrnpll	UTSW	17	80061956	missense	unknown
R8068:Hnrnpll	UTSW	17	80050852	missense	possibly damaging	0.80
R8381:Hnrnpll	UTSW	17	80030491	missense	probably damaging	1.00
Z1177:Hnrnpll	UTSW	17	80048610	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTAGGCTCTACGTACACAAACC -3'
(R):5'- GGATAAATGGTTGCCTGCACC -3'

Sequencing Primer
(F):5'- TAGGCTCTACGTACACAAACCCAAAC -3'
(R):5'- GGTTGCCTGCACCAAATTTAAATAGC -3'

Posted On

2020-01-23