Incidental Mutation 'R8061:Plcb1'
ID619688
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Namephospholipase C, beta 1
Synonyms3110043I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R8061 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location134786067-135475258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135346396 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 803 (Y803F)
Ref Sequence ENSEMBL: ENSMUSP00000105743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
Predicted Effect probably benign
Transcript: ENSMUST00000070724
AA Change: Y803F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: Y803F

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110116
AA Change: Y803F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: Y803F

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131552
AA Change: Y803F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: Y803F

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A G 9: 8,042,671 W37R probably damaging Het
Acads G A 5: 115,117,651 R42C probably benign Het
Agrn G A 4: 156,178,954 R338C probably damaging Het
Anapc1 T C 2: 128,648,488 E1008G probably damaging Het
Art5 A T 7: 102,098,249 Y108N possibly damaging Het
As3mt G A 19: 46,740,543 C369Y probably damaging Het
Asb3 A G 11: 30,998,447 N41S probably damaging Het
Astn1 G A 1: 158,504,350 probably null Het
Asxl3 T A 18: 22,524,243 M1770K possibly damaging Het
Atp8b2 T C 3: 89,946,220 probably benign Het
Chrm1 T C 19: 8,679,154 Y408H possibly damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cnot1 A G 8: 95,765,027 F390L possibly damaging Het
Comt T C 16: 18,411,290 Y100C probably benign Het
Dclk2 T C 3: 86,813,674 probably benign Het
Dicer1 G A 12: 104,702,818 Q1202* probably null Het
Disp1 C T 1: 183,087,587 V1090M probably damaging Het
Dnajc28 T C 16: 91,617,170 D62G possibly damaging Het
Dock1 C T 7: 134,772,323 T566I probably benign Het
Dopey1 T G 9: 86,521,193 M18R possibly damaging Het
Dopey2 T C 16: 93,749,996 L296P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab3 A T 11: 105,106,449 D155V probably benign Het
Ehmt2 T C 17: 34,905,927 S465P possibly damaging Het
Eno1b G A 18: 48,047,658 W301* probably null Het
Fam49a G T 12: 12,362,027 A150S possibly damaging Het
Fpgt A G 3: 155,087,266 S375P probably benign Het
Gas2l1 G A 11: 5,061,785 S348F possibly damaging Het
Gen1 A T 12: 11,261,076 probably benign Het
Gm16486 A G 8: 70,708,575 E139G probably benign Het
Ice1 A T 13: 70,603,732 C1412S probably damaging Het
Klhl2 A C 8: 64,758,223 L264V probably damaging Het
Lars2 A G 9: 123,459,497 T803A probably benign Het
Ldb2 T A 5: 44,480,270 K232M probably damaging Het
Lix1 G A 17: 17,443,676 R92Q probably damaging Het
Meig1 C T 2: 3,409,203 V87I not run Het
Mitf A C 6: 97,993,298 S176R probably damaging Het
Myh7 A G 14: 54,990,941 V236A probably benign Het
Myo5a T A 9: 75,122,957 Y119* probably null Het
Ncapg2 A G 12: 116,426,577 N382S probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr753-ps1 A G 17: 37,169,901 F147S probably damaging Het
Osbpl5 C T 7: 143,702,724 R454Q probably benign Het
Panx1 A G 9: 15,045,001 S13P possibly damaging Het
Pde2a A G 7: 101,503,972 D413G probably benign Het
Prrc2a T C 17: 35,161,186 probably benign Het
Pth2r T A 1: 65,343,501 Y143N possibly damaging Het
Ptpn4 C T 1: 119,691,600 probably null Het
Rapgef3 T C 15: 97,761,520 Y112C probably benign Het
Rusc2 A G 4: 43,422,492 N907S probably damaging Het
Scn7a T A 2: 66,692,594 N922I probably damaging Het
Shprh T C 10: 11,212,333 V1620A possibly damaging Het
Slc25a54 T A 3: 109,111,045 S280R probably damaging Het
Slc30a5 T C 13: 100,828,911 I63M probably damaging Het
Smg1 A T 7: 118,152,387 V2817E unknown Het
Sprr3 T C 3: 92,456,877 E220G probably damaging Het
Tcf21 T C 10: 22,819,863 E14G probably benign Het
Tenm4 A G 7: 96,852,456 D1289G probably damaging Het
Tmem121b C A 6: 120,492,103 G551V probably damaging Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Trib1 T C 15: 59,651,555 I146T probably damaging Het
Ttc32 T A 12: 9,034,953 Y58N probably damaging Het
Vcan T A 13: 89,657,290 I3336L probably benign Het
Vmn1r200 C A 13: 22,395,283 Y85* probably null Het
Vps39 T C 2: 120,344,211 I97V probably benign Het
Zan T A 5: 137,436,631 I2167F unknown Het
Zfp37 A T 4: 62,191,428 Y507* probably null Het
Zfp39 A G 11: 58,902,747 V55A probably benign Het
Zfp616 A T 11: 74,083,514 N294I possibly damaging Het
Zfp729a T C 13: 67,620,089 T674A probably benign Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
BB001:Plcb1 UTSW 2 135359693 missense probably benign 0.00
BB011:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1866:Plcb1 UTSW 2 135344173 missense probably benign 0.01
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3161:Plcb1 UTSW 2 135335482 missense probably benign 0.03
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135344158 missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135345095 missense probably benign 0.01
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135260566 missense probably benign 0.08
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135251764 nonsense probably null
R7498:Plcb1 UTSW 2 135262233 nonsense probably null
R7498:Plcb1 UTSW 2 135262234 missense probably damaging 0.99
R7777:Plcb1 UTSW 2 135220757 missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R8099:Plcb1 UTSW 2 135251734 missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135335476 missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135317790 missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135250052 critical splice donor site probably null
R8549:Plcb1 UTSW 2 135364933 missense probably benign 0.00
R8693:Plcb1 UTSW 2 135252776 missense probably benign 0.00
R8750:Plcb1 UTSW 2 135335449 missense probably damaging 1.00
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCAGAGCCATCAGTGTTTG -3'
(R):5'- CTGGTTAGGATTCCAATGGACAC -3'

Sequencing Primer
(F):5'- CTGTTTGTAGAGCACCACAGG -3'
(R):5'- TTCCAATGGACACAGAAAGGTTC -3'
Posted On2020-01-23