Incidental Mutation 'R8061:Tpk1'
ID619698
Institutional Source Beutler Lab
Gene Symbol Tpk1
Ensembl Gene ENSMUSG00000029735
Gene Namethiamine pyrophosphokinase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8061 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location43345001-43666278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43346844 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 224 (S224P)
Ref Sequence ENSEMBL: ENSMUSP00000065631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067888] [ENSMUST00000114644]
PDB Structure
Mouse Thiamin Pyrophosphokinase Complexed with Thiamin [X-RAY DIFFRACTION]
Mouse Thiamin Pyrophosphokinase in a Ternary Complex with Pyrithiamin Pyrophosphate and AMP at 2.5 angstrom [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000067888
AA Change: S224P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065631
Gene: ENSMUSG00000029735
AA Change: S224P

DomainStartEndE-ValueType
Pfam:TPK_catalytic 30 155 2.4e-44 PFAM
TPK_B1_binding 168 235 5.12e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114644
AA Change: S175P

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110291
Gene: ENSMUSG00000029735
AA Change: S175P

DomainStartEndE-ValueType
TPK_B1_binding 119 186 5.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203649
Meta Mutation Damage Score 0.2119 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, that exists as a homodimer, which catalyzes the conversion of thiamine to thiamine pyrophosphate. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A G 9: 8,042,671 W37R probably damaging Het
Acads G A 5: 115,117,651 R42C probably benign Het
Agrn G A 4: 156,178,954 R338C probably damaging Het
Anapc1 T C 2: 128,648,488 E1008G probably damaging Het
Art5 A T 7: 102,098,249 Y108N possibly damaging Het
As3mt G A 19: 46,740,543 C369Y probably damaging Het
Asb3 A G 11: 30,998,447 N41S probably damaging Het
Astn1 G A 1: 158,504,350 probably null Het
Asxl3 T A 18: 22,524,243 M1770K possibly damaging Het
Chrm1 T C 19: 8,679,154 Y408H possibly damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cnot1 A G 8: 95,765,027 F390L possibly damaging Het
Comt T C 16: 18,411,290 Y100C probably benign Het
Dicer1 G A 12: 104,702,818 Q1202* probably null Het
Disp1 C T 1: 183,087,587 V1090M probably damaging Het
Dnajc28 T C 16: 91,617,170 D62G possibly damaging Het
Dock1 C T 7: 134,772,323 T566I probably benign Het
Dopey1 T G 9: 86,521,193 M18R possibly damaging Het
Dopey2 T C 16: 93,749,996 L296P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab3 A T 11: 105,106,449 D155V probably benign Het
Ehmt2 T C 17: 34,905,927 S465P possibly damaging Het
Eno1b G A 18: 48,047,658 W301* probably null Het
Fam49a G T 12: 12,362,027 A150S possibly damaging Het
Fpgt A G 3: 155,087,266 S375P probably benign Het
Gas2l1 G A 11: 5,061,785 S348F possibly damaging Het
Gm16486 A G 8: 70,708,575 E139G probably benign Het
Ice1 A T 13: 70,603,732 C1412S probably damaging Het
Klhl2 A C 8: 64,758,223 L264V probably damaging Het
Lars2 A G 9: 123,459,497 T803A probably benign Het
Ldb2 T A 5: 44,480,270 K232M probably damaging Het
Lix1 G A 17: 17,443,676 R92Q probably damaging Het
Meig1 C T 2: 3,409,203 V87I not run Het
Mitf A C 6: 97,993,298 S176R probably damaging Het
Myh7 A G 14: 54,990,941 V236A probably benign Het
Myo5a T A 9: 75,122,957 Y119* probably null Het
Ncapg2 A G 12: 116,426,577 N382S probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr753-ps1 A G 17: 37,169,901 F147S probably damaging Het
Osbpl5 C T 7: 143,702,724 R454Q probably benign Het
Panx1 A G 9: 15,045,001 S13P possibly damaging Het
Pde2a A G 7: 101,503,972 D413G probably benign Het
Plcb1 A T 2: 135,346,396 Y803F probably benign Het
Pth2r T A 1: 65,343,501 Y143N possibly damaging Het
Ptpn4 C T 1: 119,691,600 probably null Het
Rapgef3 T C 15: 97,761,520 Y112C probably benign Het
Rusc2 A G 4: 43,422,492 N907S probably damaging Het
Scn7a T A 2: 66,692,594 N922I probably damaging Het
Shprh T C 10: 11,212,333 V1620A possibly damaging Het
Slc25a54 T A 3: 109,111,045 S280R probably damaging Het
Slc30a5 T C 13: 100,828,911 I63M probably damaging Het
Smg1 A T 7: 118,152,387 V2817E unknown Het
Sprr3 T C 3: 92,456,877 E220G probably damaging Het
Tcf21 T C 10: 22,819,863 E14G probably benign Het
Tenm4 A G 7: 96,852,456 D1289G probably damaging Het
Tmem121b C A 6: 120,492,103 G551V probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Trib1 T C 15: 59,651,555 I146T probably damaging Het
Ttc32 T A 12: 9,034,953 Y58N probably damaging Het
Vcan T A 13: 89,657,290 I3336L probably benign Het
Vmn1r200 C A 13: 22,395,283 Y85* probably null Het
Vps39 T C 2: 120,344,211 I97V probably benign Het
Zan T A 5: 137,436,631 I2167F unknown Het
Zfp37 A T 4: 62,191,428 Y507* probably null Het
Zfp39 A G 11: 58,902,747 V55A probably benign Het
Zfp616 A T 11: 74,083,514 N294I possibly damaging Het
Zfp729a T C 13: 67,620,089 T674A probably benign Het
Other mutations in Tpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0084:Tpk1 UTSW 6 43346829 missense possibly damaging 0.94
R1736:Tpk1 UTSW 6 43611350 missense probably benign 0.09
R2348:Tpk1 UTSW 6 43346844 missense probably damaging 0.97
R4664:Tpk1 UTSW 6 43611335 missense probably benign 0.08
R4804:Tpk1 UTSW 6 43593078 intron probably benign
R5172:Tpk1 UTSW 6 43560017 splice site probably null
R5230:Tpk1 UTSW 6 43423719 missense probably damaging 1.00
R5485:Tpk1 UTSW 6 43665812 utr 5 prime probably benign
R6126:Tpk1 UTSW 6 43423660 missense probably damaging 1.00
R6140:Tpk1 UTSW 6 43423701 missense probably benign 0.00
R6326:Tpk1 UTSW 6 43346802 missense possibly damaging 0.77
R6460:Tpk1 UTSW 6 43469027 missense probably benign 0.01
R6767:Tpk1 UTSW 6 43346793 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTGAAAGCTCATGGTTCCCC -3'
(R):5'- ACACTGTAGAAGTTCTTGCTTTGAG -3'

Sequencing Primer
(F):5'- GGTTCCCCATGGAGAAGTTTAC -3'
(R):5'- TTTGAGAACCCGACACCATGGG -3'
Posted On2020-01-23