Incidental Mutation 'R8061:Smg1'
ID 619704
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms 5430435M13Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans), 2610207I05Rik, C130002K18Rik
MMRRC Submission 067497-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8061 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 117730531-117842893 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117751610 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 2817 (V2817E)
Ref Sequence ENSEMBL: ENSMUSP00000032891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: V2817E
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: V2817E

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads G A 5: 115,255,710 (GRCm39) R42C probably benign Het
Agrn G A 4: 156,263,411 (GRCm39) R338C probably damaging Het
Anapc1 T C 2: 128,490,408 (GRCm39) E1008G probably damaging Het
Art5 A T 7: 101,747,456 (GRCm39) Y108N possibly damaging Het
As3mt G A 19: 46,728,982 (GRCm39) C369Y probably damaging Het
Asb3 A G 11: 30,948,447 (GRCm39) N41S probably damaging Het
Astn1 G A 1: 158,331,920 (GRCm39) probably null Het
Asxl3 T A 18: 22,657,300 (GRCm39) M1770K possibly damaging Het
Atp8b2 T C 3: 89,853,527 (GRCm39) probably benign Het
Cfap300 A G 9: 8,042,672 (GRCm39) W37R probably damaging Het
Chrm1 T C 19: 8,656,518 (GRCm39) Y408H possibly damaging Het
Chst2 T C 9: 95,287,224 (GRCm39) H374R probably damaging Het
Cnot1 A G 8: 96,491,655 (GRCm39) F390L possibly damaging Het
Comt T C 16: 18,230,040 (GRCm39) Y100C probably benign Het
Cyria G T 12: 12,412,028 (GRCm39) A150S possibly damaging Het
Dclk2 T C 3: 86,720,981 (GRCm39) probably benign Het
Dicer1 G A 12: 104,669,077 (GRCm39) Q1202* probably null Het
Disp1 C T 1: 182,869,151 (GRCm39) V1090M probably damaging Het
Dnajc28 T C 16: 91,414,058 (GRCm39) D62G possibly damaging Het
Dock1 C T 7: 134,374,052 (GRCm39) T566I probably benign Het
Dop1a T G 9: 86,403,246 (GRCm39) M18R possibly damaging Het
Dop1b T C 16: 93,546,884 (GRCm39) L296P probably damaging Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Efcab3 A T 11: 104,997,275 (GRCm39) D155V probably benign Het
Ehmt2 T C 17: 35,124,903 (GRCm39) S465P possibly damaging Het
Eno1b G A 18: 48,180,725 (GRCm39) W301* probably null Het
Fpgt A G 3: 154,792,903 (GRCm39) S375P probably benign Het
Gas2l1 G A 11: 5,011,785 (GRCm39) S348F possibly damaging Het
Gen1 A T 12: 11,311,077 (GRCm39) probably benign Het
Ice1 A T 13: 70,751,851 (GRCm39) C1412S probably damaging Het
Iqcn A G 8: 71,161,224 (GRCm39) E139G probably benign Het
Klhl2 A C 8: 65,211,257 (GRCm39) L264V probably damaging Het
Lars2 A G 9: 123,288,562 (GRCm39) T803A probably benign Het
Ldb2 T A 5: 44,637,612 (GRCm39) K232M probably damaging Het
Lix1 G A 17: 17,663,938 (GRCm39) R92Q probably damaging Het
Meig1 C T 2: 3,410,240 (GRCm39) V87I not run Het
Mitf A C 6: 97,970,259 (GRCm39) S176R probably damaging Het
Myh7 A G 14: 55,228,398 (GRCm39) V236A probably benign Het
Myo5a T A 9: 75,030,239 (GRCm39) Y119* probably null Het
Ncapg2 A G 12: 116,390,197 (GRCm39) N382S probably benign Het
Neu2 C T 1: 87,524,633 (GRCm39) P206L probably damaging Het
Or2h2b-ps1 A G 17: 37,480,792 (GRCm39) F147S probably damaging Het
Osbpl5 C T 7: 143,256,461 (GRCm39) R454Q probably benign Het
Panx1 A G 9: 14,956,297 (GRCm39) S13P possibly damaging Het
Pde2a A G 7: 101,153,179 (GRCm39) D413G probably benign Het
Plcb1 A T 2: 135,188,316 (GRCm39) Y803F probably benign Het
Prrc2a T C 17: 35,380,162 (GRCm39) probably benign Het
Pth2r T A 1: 65,382,660 (GRCm39) Y143N possibly damaging Het
Ptpn4 C T 1: 119,619,330 (GRCm39) probably null Het
Rapgef3 T C 15: 97,659,401 (GRCm39) Y112C probably benign Het
Rusc2 A G 4: 43,422,492 (GRCm39) N907S probably damaging Het
Scn7a T A 2: 66,522,938 (GRCm39) N922I probably damaging Het
Shprh T C 10: 11,088,077 (GRCm39) V1620A possibly damaging Het
Slc25a54 T A 3: 109,018,361 (GRCm39) S280R probably damaging Het
Slc30a5 T C 13: 100,965,419 (GRCm39) I63M probably damaging Het
Sprr3 T C 3: 92,364,184 (GRCm39) E220G probably damaging Het
Tcf21 T C 10: 22,695,762 (GRCm39) E14G probably benign Het
Tenm4 A G 7: 96,501,663 (GRCm39) D1289G probably damaging Het
Tmem121b C A 6: 120,469,064 (GRCm39) G551V probably damaging Het
Tpk1 A G 6: 43,323,778 (GRCm39) S224P probably damaging Het
Trib1 T C 15: 59,523,404 (GRCm39) I146T probably damaging Het
Ttc32 T A 12: 9,084,953 (GRCm39) Y58N probably damaging Het
Vcan T A 13: 89,805,409 (GRCm39) I3336L probably benign Het
Vmn1r200 C A 13: 22,579,453 (GRCm39) Y85* probably null Het
Vps39 T C 2: 120,174,692 (GRCm39) I97V probably benign Het
Zan T A 5: 137,434,893 (GRCm39) I2167F unknown Het
Zfp37 A T 4: 62,109,665 (GRCm39) Y507* probably null Het
Zfp39 A G 11: 58,793,573 (GRCm39) V55A probably benign Het
Zfp616 A T 11: 73,974,340 (GRCm39) N294I possibly damaging Het
Zfp729a T C 13: 67,768,208 (GRCm39) T674A probably benign Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 117,797,494 (GRCm39) utr 3 prime probably benign
IGL00481:Smg1 APN 7 117,810,017 (GRCm39) missense possibly damaging 0.67
IGL00503:Smg1 APN 7 117,784,706 (GRCm39) utr 3 prime probably benign
IGL00927:Smg1 APN 7 117,739,855 (GRCm39) missense probably damaging 1.00
IGL01333:Smg1 APN 7 117,762,601 (GRCm39) splice site probably benign
IGL01344:Smg1 APN 7 117,790,059 (GRCm39) utr 3 prime probably benign
IGL01397:Smg1 APN 7 117,762,444 (GRCm39) utr 3 prime probably benign
IGL01403:Smg1 APN 7 117,757,355 (GRCm39) utr 3 prime probably benign
IGL01573:Smg1 APN 7 117,767,185 (GRCm39) utr 3 prime probably benign
IGL01872:Smg1 APN 7 117,748,167 (GRCm39) utr 3 prime probably benign
IGL02010:Smg1 APN 7 117,785,369 (GRCm39) utr 3 prime probably benign
IGL02158:Smg1 APN 7 117,812,169 (GRCm39) missense possibly damaging 0.77
IGL02268:Smg1 APN 7 117,781,764 (GRCm39) missense probably benign 0.19
IGL02314:Smg1 APN 7 117,753,932 (GRCm39) utr 3 prime probably benign
IGL02552:Smg1 APN 7 117,795,117 (GRCm39) utr 3 prime probably benign
IGL02577:Smg1 APN 7 117,802,345 (GRCm39) missense probably damaging 0.99
IGL02859:Smg1 APN 7 117,748,156 (GRCm39) utr 3 prime probably benign
IGL02890:Smg1 APN 7 117,784,724 (GRCm39) utr 3 prime probably benign
IGL02892:Smg1 APN 7 117,767,178 (GRCm39) utr 3 prime probably benign
IGL03119:Smg1 APN 7 117,794,336 (GRCm39) utr 3 prime probably benign
IGL03123:Smg1 APN 7 117,756,404 (GRCm39) utr 3 prime probably benign
IGL03128:Smg1 APN 7 117,802,282 (GRCm39) missense probably benign 0.03
IGL03184:Smg1 APN 7 117,779,603 (GRCm39) missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 117,784,764 (GRCm39) missense unknown
R0010:Smg1 UTSW 7 117,771,082 (GRCm39) utr 3 prime probably benign
R0010:Smg1 UTSW 7 117,771,082 (GRCm39) utr 3 prime probably benign
R0025:Smg1 UTSW 7 117,811,666 (GRCm39) missense possibly damaging 0.92
R0025:Smg1 UTSW 7 117,811,666 (GRCm39) missense possibly damaging 0.92
R0098:Smg1 UTSW 7 117,744,690 (GRCm39) missense probably benign 0.02
R0139:Smg1 UTSW 7 117,751,898 (GRCm39) critical splice donor site probably null
R0371:Smg1 UTSW 7 117,767,523 (GRCm39) utr 3 prime probably benign
R0415:Smg1 UTSW 7 117,781,691 (GRCm39) missense probably benign 0.34
R0416:Smg1 UTSW 7 117,783,684 (GRCm39) splice site probably benign
R0423:Smg1 UTSW 7 117,776,103 (GRCm39) missense possibly damaging 0.53
R0600:Smg1 UTSW 7 117,759,606 (GRCm39) utr 3 prime probably benign
R0626:Smg1 UTSW 7 117,781,606 (GRCm39) missense possibly damaging 0.82
R0627:Smg1 UTSW 7 117,767,084 (GRCm39) utr 3 prime probably benign
R0727:Smg1 UTSW 7 117,765,645 (GRCm39) utr 3 prime probably benign
R0729:Smg1 UTSW 7 117,745,512 (GRCm39) utr 3 prime probably benign
R0841:Smg1 UTSW 7 117,742,524 (GRCm39) missense possibly damaging 0.96
R1114:Smg1 UTSW 7 117,759,013 (GRCm39) utr 3 prime probably benign
R1256:Smg1 UTSW 7 117,802,310 (GRCm39) missense probably damaging 1.00
R1298:Smg1 UTSW 7 117,767,434 (GRCm39) utr 3 prime probably benign
R1370:Smg1 UTSW 7 117,758,975 (GRCm39) utr 3 prime probably benign
R1591:Smg1 UTSW 7 117,756,142 (GRCm39) utr 3 prime probably benign
R1736:Smg1 UTSW 7 117,765,190 (GRCm39) splice site probably null
R1755:Smg1 UTSW 7 117,802,287 (GRCm39) nonsense probably null
R1765:Smg1 UTSW 7 117,738,938 (GRCm39) missense probably benign 0.03
R1789:Smg1 UTSW 7 117,745,021 (GRCm39) missense possibly damaging 0.73
R1845:Smg1 UTSW 7 117,753,845 (GRCm39) utr 3 prime probably benign
R1908:Smg1 UTSW 7 117,753,422 (GRCm39) utr 3 prime probably benign
R1909:Smg1 UTSW 7 117,753,422 (GRCm39) utr 3 prime probably benign
R1942:Smg1 UTSW 7 117,757,326 (GRCm39) utr 3 prime probably benign
R2064:Smg1 UTSW 7 117,756,090 (GRCm39) utr 3 prime probably benign
R2072:Smg1 UTSW 7 117,762,389 (GRCm39) utr 3 prime probably benign
R2154:Smg1 UTSW 7 117,757,299 (GRCm39) utr 3 prime probably benign
R2895:Smg1 UTSW 7 117,788,366 (GRCm39) utr 3 prime probably benign
R2915:Smg1 UTSW 7 117,810,102 (GRCm39) splice site probably benign
R3416:Smg1 UTSW 7 117,748,076 (GRCm39) utr 3 prime probably benign
R3417:Smg1 UTSW 7 117,748,076 (GRCm39) utr 3 prime probably benign
R3873:Smg1 UTSW 7 117,753,885 (GRCm39) utr 3 prime probably benign
R4082:Smg1 UTSW 7 117,759,469 (GRCm39) utr 3 prime probably benign
R4230:Smg1 UTSW 7 117,747,956 (GRCm39) critical splice donor site probably null
R4304:Smg1 UTSW 7 117,738,741 (GRCm39) missense probably benign 0.03
R4549:Smg1 UTSW 7 117,758,906 (GRCm39) utr 3 prime probably benign
R4571:Smg1 UTSW 7 117,738,688 (GRCm39) missense possibly damaging 0.72
R4638:Smg1 UTSW 7 117,795,149 (GRCm39) utr 3 prime probably benign
R4642:Smg1 UTSW 7 117,753,487 (GRCm39) utr 3 prime probably benign
R4656:Smg1 UTSW 7 117,812,174 (GRCm39) missense probably benign 0.00
R4754:Smg1 UTSW 7 117,755,954 (GRCm39) utr 3 prime probably benign
R4798:Smg1 UTSW 7 117,779,697 (GRCm39) missense probably benign 0.32
R4906:Smg1 UTSW 7 117,751,631 (GRCm39) utr 3 prime probably benign
R4978:Smg1 UTSW 7 117,753,470 (GRCm39) utr 3 prime probably benign
R4989:Smg1 UTSW 7 117,807,274 (GRCm39) missense probably benign
R4989:Smg1 UTSW 7 117,757,323 (GRCm39) utr 3 prime probably benign
R5026:Smg1 UTSW 7 117,792,768 (GRCm39) utr 3 prime probably benign
R5124:Smg1 UTSW 7 117,812,235 (GRCm39) missense probably benign 0.00
R5318:Smg1 UTSW 7 117,759,427 (GRCm39) utr 3 prime probably benign
R5356:Smg1 UTSW 7 117,794,356 (GRCm39) utr 3 prime probably benign
R5404:Smg1 UTSW 7 117,806,131 (GRCm39) missense probably damaging 1.00
R5423:Smg1 UTSW 7 117,745,294 (GRCm39) missense possibly damaging 0.70
R5441:Smg1 UTSW 7 117,794,304 (GRCm39) utr 3 prime probably benign
R5490:Smg1 UTSW 7 117,738,659 (GRCm39) missense possibly damaging 0.86
R5541:Smg1 UTSW 7 117,756,386 (GRCm39) utr 3 prime probably benign
R5564:Smg1 UTSW 7 117,789,042 (GRCm39) utr 3 prime probably benign
R5580:Smg1 UTSW 7 117,748,125 (GRCm39) utr 3 prime probably benign
R5600:Smg1 UTSW 7 117,767,107 (GRCm39) utr 3 prime probably benign
R5628:Smg1 UTSW 7 117,753,924 (GRCm39) utr 3 prime probably benign
R5646:Smg1 UTSW 7 117,811,782 (GRCm39) missense probably benign 0.42
R5656:Smg1 UTSW 7 117,753,887 (GRCm39) utr 3 prime probably benign
R5660:Smg1 UTSW 7 117,742,570 (GRCm39) missense probably benign 0.33
R5706:Smg1 UTSW 7 117,744,813 (GRCm39) missense possibly damaging 0.86
R5786:Smg1 UTSW 7 117,812,120 (GRCm39) missense probably benign 0.12
R5890:Smg1 UTSW 7 117,789,809 (GRCm39) utr 3 prime probably benign
R5912:Smg1 UTSW 7 117,753,809 (GRCm39) utr 3 prime probably benign
R5977:Smg1 UTSW 7 117,740,580 (GRCm39) utr 3 prime probably benign
R5993:Smg1 UTSW 7 117,739,732 (GRCm39) missense probably benign 0.33
R6161:Smg1 UTSW 7 117,762,553 (GRCm39) utr 3 prime probably benign
R6187:Smg1 UTSW 7 117,788,386 (GRCm39) utr 3 prime probably benign
R6264:Smg1 UTSW 7 117,765,310 (GRCm39) utr 3 prime probably benign
R6331:Smg1 UTSW 7 117,753,500 (GRCm39) utr 3 prime probably benign
R6561:Smg1 UTSW 7 117,765,300 (GRCm39) utr 3 prime probably benign
R6571:Smg1 UTSW 7 117,783,737 (GRCm39) utr 3 prime probably benign
R6736:Smg1 UTSW 7 117,756,389 (GRCm39) utr 3 prime probably benign
R6752:Smg1 UTSW 7 117,762,539 (GRCm39) utr 3 prime probably benign
R6777:Smg1 UTSW 7 117,788,340 (GRCm39) utr 3 prime probably benign
R6788:Smg1 UTSW 7 117,783,794 (GRCm39) utr 3 prime probably benign
R6883:Smg1 UTSW 7 117,767,403 (GRCm39) utr 3 prime probably benign
R6991:Smg1 UTSW 7 117,767,091 (GRCm39) utr 3 prime probably benign
R7056:Smg1 UTSW 7 117,745,623 (GRCm39) splice site probably benign
R7058:Smg1 UTSW 7 117,797,502 (GRCm39) utr 3 prime probably benign
R7100:Smg1 UTSW 7 117,783,743 (GRCm39) missense unknown
R7133:Smg1 UTSW 7 117,752,131 (GRCm39) missense unknown
R7221:Smg1 UTSW 7 117,782,020 (GRCm39) missense possibly damaging 0.86
R7229:Smg1 UTSW 7 117,776,178 (GRCm39) missense probably benign 0.03
R7293:Smg1 UTSW 7 117,765,322 (GRCm39) missense unknown
R7361:Smg1 UTSW 7 117,784,200 (GRCm39) missense unknown
R7438:Smg1 UTSW 7 117,795,116 (GRCm39) missense unknown
R7686:Smg1 UTSW 7 117,767,081 (GRCm39) missense unknown
R7798:Smg1 UTSW 7 117,771,162 (GRCm39) missense possibly damaging 0.73
R7908:Smg1 UTSW 7 117,785,357 (GRCm39) missense unknown
R7923:Smg1 UTSW 7 117,742,545 (GRCm39) missense possibly damaging 0.96
R7978:Smg1 UTSW 7 117,792,878 (GRCm39) missense unknown
R7997:Smg1 UTSW 7 117,772,365 (GRCm39) missense unknown
R7997:Smg1 UTSW 7 117,772,364 (GRCm39) missense unknown
R8025:Smg1 UTSW 7 117,806,212 (GRCm39) nonsense probably null
R8056:Smg1 UTSW 7 117,759,589 (GRCm39) missense unknown
R8095:Smg1 UTSW 7 117,772,285 (GRCm39) missense unknown
R8198:Smg1 UTSW 7 117,744,829 (GRCm39) missense probably benign 0.03
R8399:Smg1 UTSW 7 117,789,794 (GRCm39) missense unknown
R8445:Smg1 UTSW 7 117,736,200 (GRCm39) missense possibly damaging 0.72
R8519:Smg1 UTSW 7 117,770,982 (GRCm39) utr 3 prime probably benign
R8817:Smg1 UTSW 7 117,758,887 (GRCm39) missense unknown
R8832:Smg1 UTSW 7 117,739,006 (GRCm39) missense probably benign 0.33
R8855:Smg1 UTSW 7 117,806,122 (GRCm39) missense unknown
R8866:Smg1 UTSW 7 117,806,122 (GRCm39) missense unknown
R8946:Smg1 UTSW 7 117,751,900 (GRCm39) missense probably null
R8954:Smg1 UTSW 7 117,806,215 (GRCm39) missense probably damaging 1.00
R8967:Smg1 UTSW 7 117,765,739 (GRCm39) missense unknown
R9072:Smg1 UTSW 7 117,783,032 (GRCm39) missense unknown
R9090:Smg1 UTSW 7 117,811,786 (GRCm39) missense unknown
R9156:Smg1 UTSW 7 117,753,884 (GRCm39) missense unknown
R9198:Smg1 UTSW 7 117,795,179 (GRCm39) missense unknown
R9240:Smg1 UTSW 7 117,739,031 (GRCm39) missense probably benign 0.18
R9271:Smg1 UTSW 7 117,811,786 (GRCm39) missense unknown
R9289:Smg1 UTSW 7 117,744,639 (GRCm39) missense possibly damaging 0.53
R9378:Smg1 UTSW 7 117,777,998 (GRCm39) nonsense probably null
R9396:Smg1 UTSW 7 117,807,303 (GRCm39) missense unknown
R9469:Smg1 UTSW 7 117,739,774 (GRCm39) missense possibly damaging 0.72
R9539:Smg1 UTSW 7 117,744,976 (GRCm39) missense probably benign 0.03
R9549:Smg1 UTSW 7 117,795,254 (GRCm39) missense unknown
R9563:Smg1 UTSW 7 117,812,208 (GRCm39) missense unknown
R9564:Smg1 UTSW 7 117,812,208 (GRCm39) missense unknown
R9597:Smg1 UTSW 7 117,812,270 (GRCm39) missense unknown
R9643:Smg1 UTSW 7 117,755,933 (GRCm39) missense unknown
R9703:Smg1 UTSW 7 117,739,744 (GRCm39) missense possibly damaging 0.73
R9730:Smg1 UTSW 7 117,783,004 (GRCm39) missense unknown
Z1088:Smg1 UTSW 7 117,777,622 (GRCm39) missense possibly damaging 0.96
Z1088:Smg1 UTSW 7 117,767,884 (GRCm39) nonsense probably null
Z1088:Smg1 UTSW 7 117,753,858 (GRCm39) utr 3 prime probably benign
Z1176:Smg1 UTSW 7 117,806,130 (GRCm39) missense unknown
Z1176:Smg1 UTSW 7 117,806,110 (GRCm39) missense unknown
Z1177:Smg1 UTSW 7 117,812,256 (GRCm39) missense unknown
Z1177:Smg1 UTSW 7 117,767,831 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- GCCTGATAATCTGTTTTGCCGC -3'
(R):5'- ACTTGGCCAGTGTTTGTCAC -3'

Sequencing Primer
(F):5'- CCAGTATTACAGGCTTGTGACAC -3'
(R):5'- GTCACTTTGAGATTTGAAGTCTTCTC -3'
Posted On 2020-01-23