Incidental Mutation 'R8061:Osbpl5'
ID619706
Institutional Source Beutler Lab
Gene Symbol Osbpl5
Ensembl Gene ENSMUSG00000037606
Gene Nameoxysterol binding protein-like 5
SynonymsObph1, ORP5, 1110006M06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_024289 ; MGI: 1930265

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8061 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143688762-143756985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143702724 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 454 (R454Q)
Ref Sequence ENSEMBL: ENSMUSP00000020411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020411] [ENSMUST00000119499]
Predicted Effect probably benign
Transcript: ENSMUST00000020411
AA Change: R454Q

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020411
Gene: ENSMUSG00000037606
AA Change: R454Q

DomainStartEndE-ValueType
PH 151 269 1.02e-14 SMART
Pfam:Oxysterol_BP 394 738 2.9e-91 PFAM
transmembrane domain 879 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119499
AA Change: R430Q

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113362
Gene: ENSMUSG00000037606
AA Change: R430Q

DomainStartEndE-ValueType
coiled coil region 92 122 N/A INTRINSIC
PH 127 245 1.02e-14 SMART
Pfam:Oxysterol_BP 369 724 1e-93 PFAM
transmembrane domain 855 873 N/A INTRINSIC
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors that play a key role in the maintenance of cholesterol balance in the body. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. This gene has been shown to be imprinted, with preferential expression from the maternal allele only in placenta. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A G 9: 8,042,671 W37R probably damaging Het
Acads G A 5: 115,117,651 R42C probably benign Het
Agrn G A 4: 156,178,954 R338C probably damaging Het
Anapc1 T C 2: 128,648,488 E1008G probably damaging Het
Art5 A T 7: 102,098,249 Y108N possibly damaging Het
As3mt G A 19: 46,740,543 C369Y probably damaging Het
Asb3 A G 11: 30,998,447 N41S probably damaging Het
Astn1 G A 1: 158,504,350 probably null Het
Asxl3 T A 18: 22,524,243 M1770K possibly damaging Het
Atp8b2 T C 3: 89,946,220 probably benign Het
Chrm1 T C 19: 8,679,154 Y408H possibly damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cnot1 A G 8: 95,765,027 F390L possibly damaging Het
Comt T C 16: 18,411,290 Y100C probably benign Het
Dclk2 T C 3: 86,813,674 probably benign Het
Dicer1 G A 12: 104,702,818 Q1202* probably null Het
Disp1 C T 1: 183,087,587 V1090M probably damaging Het
Dnajc28 T C 16: 91,617,170 D62G possibly damaging Het
Dock1 C T 7: 134,772,323 T566I probably benign Het
Dopey1 T G 9: 86,521,193 M18R possibly damaging Het
Dopey2 T C 16: 93,749,996 L296P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab3 A T 11: 105,106,449 D155V probably benign Het
Ehmt2 T C 17: 34,905,927 S465P possibly damaging Het
Eno1b G A 18: 48,047,658 W301* probably null Het
Fam49a G T 12: 12,362,027 A150S possibly damaging Het
Fpgt A G 3: 155,087,266 S375P probably benign Het
Gas2l1 G A 11: 5,061,785 S348F possibly damaging Het
Gen1 A T 12: 11,261,076 probably benign Het
Gm16486 A G 8: 70,708,575 E139G probably benign Het
Ice1 A T 13: 70,603,732 C1412S probably damaging Het
Klhl2 A C 8: 64,758,223 L264V probably damaging Het
Lars2 A G 9: 123,459,497 T803A probably benign Het
Ldb2 T A 5: 44,480,270 K232M probably damaging Het
Lix1 G A 17: 17,443,676 R92Q probably damaging Het
Meig1 C T 2: 3,409,203 V87I not run Het
Mitf A C 6: 97,993,298 S176R probably damaging Het
Myh7 A G 14: 54,990,941 V236A probably benign Het
Myo5a T A 9: 75,122,957 Y119* probably null Het
Ncapg2 A G 12: 116,426,577 N382S probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr753-ps1 A G 17: 37,169,901 F147S probably damaging Het
Panx1 A G 9: 15,045,001 S13P possibly damaging Het
Pde2a A G 7: 101,503,972 D413G probably benign Het
Plcb1 A T 2: 135,346,396 Y803F probably benign Het
Prrc2a T C 17: 35,161,186 probably benign Het
Pth2r T A 1: 65,343,501 Y143N possibly damaging Het
Ptpn4 C T 1: 119,691,600 probably null Het
Rapgef3 T C 15: 97,761,520 Y112C probably benign Het
Rusc2 A G 4: 43,422,492 N907S probably damaging Het
Scn7a T A 2: 66,692,594 N922I probably damaging Het
Shprh T C 10: 11,212,333 V1620A possibly damaging Het
Slc25a54 T A 3: 109,111,045 S280R probably damaging Het
Slc30a5 T C 13: 100,828,911 I63M probably damaging Het
Smg1 A T 7: 118,152,387 V2817E unknown Het
Sprr3 T C 3: 92,456,877 E220G probably damaging Het
Tcf21 T C 10: 22,819,863 E14G probably benign Het
Tenm4 A G 7: 96,852,456 D1289G probably damaging Het
Tmem121b C A 6: 120,492,103 G551V probably damaging Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Trib1 T C 15: 59,651,555 I146T probably damaging Het
Ttc32 T A 12: 9,034,953 Y58N probably damaging Het
Vcan T A 13: 89,657,290 I3336L probably benign Het
Vmn1r200 C A 13: 22,395,283 Y85* probably null Het
Vps39 T C 2: 120,344,211 I97V probably benign Het
Zan T A 5: 137,436,631 I2167F unknown Het
Zfp37 A T 4: 62,191,428 Y507* probably null Het
Zfp39 A G 11: 58,902,747 V55A probably benign Het
Zfp616 A T 11: 74,083,514 N294I possibly damaging Het
Zfp729a T C 13: 67,620,089 T674A probably benign Het
Other mutations in Osbpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Osbpl5 APN 7 143715693 nonsense probably null
IGL01996:Osbpl5 APN 7 143707344 critical splice donor site probably null
IGL02135:Osbpl5 APN 7 143705125 missense probably damaging 1.00
IGL02331:Osbpl5 APN 7 143709795 missense probably benign 0.22
IGL02993:Osbpl5 APN 7 143699334 critical splice acceptor site probably null
R0240:Osbpl5 UTSW 7 143741669 splice site probably null
R0601:Osbpl5 UTSW 7 143709549 missense probably damaging 0.98
R0609:Osbpl5 UTSW 7 143694821 missense probably damaging 0.99
R0659:Osbpl5 UTSW 7 143705030 missense probably damaging 0.97
R1532:Osbpl5 UTSW 7 143695080 missense probably benign
R1579:Osbpl5 UTSW 7 143709202 missense possibly damaging 0.93
R1595:Osbpl5 UTSW 7 143703218 missense possibly damaging 0.88
R1666:Osbpl5 UTSW 7 143709039 missense probably damaging 1.00
R1668:Osbpl5 UTSW 7 143709039 missense probably damaging 1.00
R1713:Osbpl5 UTSW 7 143694373 missense probably damaging 1.00
R1868:Osbpl5 UTSW 7 143715773 missense probably damaging 1.00
R1901:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1902:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1903:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1911:Osbpl5 UTSW 7 143689925 missense probably benign 0.00
R1982:Osbpl5 UTSW 7 143741671 critical splice donor site probably null
R2014:Osbpl5 UTSW 7 143741692 missense probably damaging 0.98
R2076:Osbpl5 UTSW 7 143709144 missense probably damaging 1.00
R2192:Osbpl5 UTSW 7 143693859 nonsense probably null
R2256:Osbpl5 UTSW 7 143709094 missense probably damaging 1.00
R4271:Osbpl5 UTSW 7 143695602 nonsense probably null
R4418:Osbpl5 UTSW 7 143709815 nonsense probably null
R4450:Osbpl5 UTSW 7 143694906 missense probably benign 0.00
R4573:Osbpl5 UTSW 7 143694316 missense probably benign 0.00
R5325:Osbpl5 UTSW 7 143691928 missense probably damaging 0.99
R5439:Osbpl5 UTSW 7 143741696 missense possibly damaging 0.83
R5617:Osbpl5 UTSW 7 143692947 missense possibly damaging 0.89
R5775:Osbpl5 UTSW 7 143704529 missense probably benign 0.00
R5935:Osbpl5 UTSW 7 143756958 start gained probably benign
R6906:Osbpl5 UTSW 7 143694328 missense probably damaging 0.99
R7076:Osbpl5 UTSW 7 143709840 missense probably benign 0.12
R7117:Osbpl5 UTSW 7 143709783 missense probably benign 0.01
R7292:Osbpl5 UTSW 7 143701278 missense probably damaging 1.00
R7555:Osbpl5 UTSW 7 143694933 missense possibly damaging 0.65
R7594:Osbpl5 UTSW 7 143693797 missense probably benign 0.02
R8028:Osbpl5 UTSW 7 143715735 missense probably benign 0.00
R8314:Osbpl5 UTSW 7 143695096 missense probably benign 0.05
R8482:Osbpl5 UTSW 7 143704994 missense probably benign 0.12
YA93:Osbpl5 UTSW 7 143693870 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGGAAGTCCAAAGAGCTGC -3'
(R):5'- TTCTCGATATGTGGTGAGCCC -3'

Sequencing Primer
(F):5'- GTCCAAAGAGCTGCCCTCC -3'
(R):5'- TGGTGAGCCCACTTGCCTAC -3'
Posted On2020-01-23