Incidental Mutation 'R0665:Olfr350'
ID 61971
Institutional Source Beutler Lab
Gene Symbol Olfr350
Ensembl Gene ENSMUSG00000050015
Gene Name olfactory receptor 350
Synonyms MOR136-13, GA_x6K02T2NLDC-33544602-33545540
MMRRC Submission 038850-MU
Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R0665 (G1)
Quality Score 124
Status Not validated
Chromosome 2
Chromosomal Location 36846310-36851702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36850190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 48 (L48P)
Ref Sequence ENSEMBL: ENSMUSP00000149667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]
AlphaFold Q8VFP8
Predicted Effect probably damaging
Transcript: ENSMUST00000055130
AA Change: L48P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: L48P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-7 PFAM
Pfam:7tm_1 41 290 3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214457
AA Change: L48P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215100
AA Change: L48P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6598 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 A G 2: 90,801,210 Y304C probably damaging Het
B3galt2 T C 1: 143,646,453 V109A possibly damaging Het
Chml T A 1: 175,687,895 E153D probably benign Het
Dap3 A T 3: 88,930,997 C78* probably null Het
Dnah8 T C 17: 30,736,155 F2053L probably damaging Het
Dppa3 A G 6: 122,629,980 E143G probably damaging Het
Espnl T G 1: 91,334,687 probably null Het
Fat3 C T 9: 15,997,402 A2435T probably benign Het
Flnc G A 6: 29,455,531 V2027M probably damaging Het
Gtf2h2 C T 13: 100,481,054 G200E probably damaging Het
Gtpbp1 A G 15: 79,713,447 I348V probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnk10 T C 12: 98,440,685 I251V probably benign Het
Kri1 G A 9: 21,281,640 probably benign Het
Lcmt1 G A 7: 123,402,871 D120N probably damaging Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Olfr1112 A G 2: 87,192,308 Y207C probably damaging Het
Olfr1136 C T 2: 87,693,808 V25I probably benign Het
Phyhd1 A G 2: 30,281,028 H241R probably damaging Het
Ppp2r5d A T 17: 46,686,404 N287K probably damaging Het
Ralgds A G 2: 28,545,206 H458R probably damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Sdhc T C 1: 171,136,057 Y80C probably damaging Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Triobp T C 15: 78,973,898 L1233P possibly damaging Het
Trpc6 A C 9: 8,634,122 T401P probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Other mutations in Olfr350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr350 APN 2 36850270 missense probably damaging 1.00
IGL01113:Olfr350 APN 2 36850619 missense probably damaging 1.00
IGL01393:Olfr350 APN 2 36850541 missense probably benign 0.01
IGL02302:Olfr350 APN 2 36850703 missense probably benign 0.02
IGL02316:Olfr350 APN 2 36850282 missense probably damaging 1.00
BB007:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
BB017:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
F6893:Olfr350 UTSW 2 36850807 missense probably benign 0.00
PIT4402001:Olfr350 UTSW 2 36850304 missense probably benign
R0312:Olfr350 UTSW 2 36850360 missense probably benign 0.01
R0525:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R0557:Olfr350 UTSW 2 36850748 missense possibly damaging 0.95
R2019:Olfr350 UTSW 2 36850406 missense possibly damaging 0.95
R2107:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2108:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2848:Olfr350 UTSW 2 36850799 missense probably damaging 1.00
R3964:Olfr350 UTSW 2 36850717 missense probably benign 0.12
R4822:Olfr350 UTSW 2 36850876 missense probably benign 0.10
R4907:Olfr350 UTSW 2 36850258 missense probably benign 0.28
R5134:Olfr350 UTSW 2 36850476 missense probably benign 0.03
R5144:Olfr350 UTSW 2 36850144 missense probably benign
R5702:Olfr350 UTSW 2 36850934 missense probably damaging 1.00
R5727:Olfr350 UTSW 2 36850532 missense possibly damaging 0.80
R5786:Olfr350 UTSW 2 36850049 start codon destroyed probably null 0.98
R6179:Olfr350 UTSW 2 36850834 missense possibly damaging 0.59
R6862:Olfr350 UTSW 2 36850222 missense possibly damaging 0.95
R7258:Olfr350 UTSW 2 36850340 missense probably damaging 0.99
R7307:Olfr350 UTSW 2 36850125 missense probably benign 0.00
R7353:Olfr350 UTSW 2 36850069 missense probably benign
R7412:Olfr350 UTSW 2 36850466 missense probably benign 0.28
R7851:Olfr350 UTSW 2 36850416 nonsense probably null
R7930:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
R8005:Olfr350 UTSW 2 36850144 missense probably benign
R8346:Olfr350 UTSW 2 36850339 missense probably benign 0.02
R8692:Olfr350 UTSW 2 36850084 missense probably benign 0.00
R9120:Olfr350 UTSW 2 36850131 nonsense probably null
R9318:Olfr350 UTSW 2 36850553 missense probably benign 0.12
Z1177:Olfr350 UTSW 2 36850239 missense probably damaging 0.99
Z1177:Olfr350 UTSW 2 36850925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGTCCCCAGATGCTGTTGAATG -3'
(R):5'- GTTGTCAGCACAGAAGGATAGCCG -3'

Sequencing Primer
(F):5'- GGTGCAACCCACTTTAAATGG -3'
(R):5'- CCGATCATATGCCATTGAAGTGAG -3'
Posted On 2013-07-30