Incidental Mutation 'R8061:Zfp39'
ID619721
Institutional Source Beutler Lab
Gene Symbol Zfp39
Ensembl Gene ENSMUSG00000037001
Gene Namezinc finger protein 39
SynonymsZfp-39, CTfin33
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R8061 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58888153-58904225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58902747 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 55 (V55A)
Ref Sequence ENSEMBL: ENSMUSP00000099764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102703]
Predicted Effect probably benign
Transcript: ENSMUST00000102703
AA Change: V55A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099764
Gene: ENSMUSG00000037001
AA Change: V55A

DomainStartEndE-ValueType
KRAB 59 119 8.23e-34 SMART
low complexity region 171 180 N/A INTRINSIC
ZnF_C2H2 298 320 9.58e-3 SMART
ZnF_C2H2 326 347 2.2e2 SMART
ZnF_C2H2 353 373 1.18e2 SMART
ZnF_C2H2 409 431 8.34e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
ZnF_C2H2 465 487 1.53e-1 SMART
ZnF_C2H2 493 515 9.08e-4 SMART
ZnF_C2H2 521 543 2.61e-4 SMART
ZnF_C2H2 549 571 1.12e-3 SMART
ZnF_C2H2 577 599 4.94e-5 SMART
ZnF_C2H2 605 627 5.14e-3 SMART
ZnF_C2H2 633 655 1.38e-3 SMART
ZnF_C2H2 661 683 6.78e-3 SMART
ZnF_C2H2 689 711 5.14e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group of transcriptional regulators in mammals. These proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation and apoptosis, and in regulating viral replication and transcription. A pseudogene of this gene was identified on chromosome 1. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A G 9: 8,042,671 W37R probably damaging Het
Acads G A 5: 115,117,651 R42C probably benign Het
Agrn G A 4: 156,178,954 R338C probably damaging Het
Anapc1 T C 2: 128,648,488 E1008G probably damaging Het
Art5 A T 7: 102,098,249 Y108N possibly damaging Het
As3mt G A 19: 46,740,543 C369Y probably damaging Het
Asb3 A G 11: 30,998,447 N41S probably damaging Het
Astn1 G A 1: 158,504,350 probably null Het
Asxl3 T A 18: 22,524,243 M1770K possibly damaging Het
Atp8b2 T C 3: 89,946,220 probably benign Het
Chrm1 T C 19: 8,679,154 Y408H possibly damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cnot1 A G 8: 95,765,027 F390L possibly damaging Het
Comt T C 16: 18,411,290 Y100C probably benign Het
Dclk2 T C 3: 86,813,674 probably benign Het
Dicer1 G A 12: 104,702,818 Q1202* probably null Het
Disp1 C T 1: 183,087,587 V1090M probably damaging Het
Dnajc28 T C 16: 91,617,170 D62G possibly damaging Het
Dock1 C T 7: 134,772,323 T566I probably benign Het
Dopey1 T G 9: 86,521,193 M18R possibly damaging Het
Dopey2 T C 16: 93,749,996 L296P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab3 A T 11: 105,106,449 D155V probably benign Het
Ehmt2 T C 17: 34,905,927 S465P possibly damaging Het
Eno1b G A 18: 48,047,658 W301* probably null Het
Fam49a G T 12: 12,362,027 A150S possibly damaging Het
Fpgt A G 3: 155,087,266 S375P probably benign Het
Gas2l1 G A 11: 5,061,785 S348F possibly damaging Het
Gen1 A T 12: 11,261,076 probably benign Het
Gm16486 A G 8: 70,708,575 E139G probably benign Het
Ice1 A T 13: 70,603,732 C1412S probably damaging Het
Klhl2 A C 8: 64,758,223 L264V probably damaging Het
Lars2 A G 9: 123,459,497 T803A probably benign Het
Ldb2 T A 5: 44,480,270 K232M probably damaging Het
Lix1 G A 17: 17,443,676 R92Q probably damaging Het
Meig1 C T 2: 3,409,203 V87I not run Het
Mitf A C 6: 97,993,298 S176R probably damaging Het
Myh7 A G 14: 54,990,941 V236A probably benign Het
Myo5a T A 9: 75,122,957 Y119* probably null Het
Ncapg2 A G 12: 116,426,577 N382S probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr753-ps1 A G 17: 37,169,901 F147S probably damaging Het
Osbpl5 C T 7: 143,702,724 R454Q probably benign Het
Panx1 A G 9: 15,045,001 S13P possibly damaging Het
Pde2a A G 7: 101,503,972 D413G probably benign Het
Plcb1 A T 2: 135,346,396 Y803F probably benign Het
Prrc2a T C 17: 35,161,186 probably benign Het
Pth2r T A 1: 65,343,501 Y143N possibly damaging Het
Ptpn4 C T 1: 119,691,600 probably null Het
Rapgef3 T C 15: 97,761,520 Y112C probably benign Het
Rusc2 A G 4: 43,422,492 N907S probably damaging Het
Scn7a T A 2: 66,692,594 N922I probably damaging Het
Shprh T C 10: 11,212,333 V1620A possibly damaging Het
Slc25a54 T A 3: 109,111,045 S280R probably damaging Het
Slc30a5 T C 13: 100,828,911 I63M probably damaging Het
Smg1 A T 7: 118,152,387 V2817E unknown Het
Sprr3 T C 3: 92,456,877 E220G probably damaging Het
Tcf21 T C 10: 22,819,863 E14G probably benign Het
Tenm4 A G 7: 96,852,456 D1289G probably damaging Het
Tmem121b C A 6: 120,492,103 G551V probably damaging Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Trib1 T C 15: 59,651,555 I146T probably damaging Het
Ttc32 T A 12: 9,034,953 Y58N probably damaging Het
Vcan T A 13: 89,657,290 I3336L probably benign Het
Vmn1r200 C A 13: 22,395,283 Y85* probably null Het
Vps39 T C 2: 120,344,211 I97V probably benign Het
Zan T A 5: 137,436,631 I2167F unknown Het
Zfp37 A T 4: 62,191,428 Y507* probably null Het
Zfp616 A T 11: 74,083,514 N294I possibly damaging Het
Zfp729a T C 13: 67,620,089 T674A probably benign Het
Other mutations in Zfp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Zfp39 APN 11 58893059 splice site probably benign
IGL01597:Zfp39 APN 11 58891543 missense probably damaging 0.96
IGL02055:Zfp39 APN 11 58891330 missense probably benign
IGL02456:Zfp39 APN 11 58902800 nonsense probably null
IGL02873:Zfp39 APN 11 58891022 missense probably benign 0.12
H8562:Zfp39 UTSW 11 58900686 missense probably damaging 1.00
R0462:Zfp39 UTSW 11 58890406 missense probably benign 0.03
R0513:Zfp39 UTSW 11 58889987 missense probably benign 0.09
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1401:Zfp39 UTSW 11 58890323 missense probably benign 0.01
R1797:Zfp39 UTSW 11 58900660 missense probably damaging 0.96
R2146:Zfp39 UTSW 11 58890332 missense probably benign 0.05
R3903:Zfp39 UTSW 11 58890175 missense probably benign 0.44
R4303:Zfp39 UTSW 11 58890017 missense probably damaging 1.00
R4706:Zfp39 UTSW 11 58902807 missense probably benign 0.41
R4957:Zfp39 UTSW 11 58891231 missense possibly damaging 0.63
R5092:Zfp39 UTSW 11 58891202 missense possibly damaging 0.71
R5158:Zfp39 UTSW 11 58889845 missense possibly damaging 0.81
R5292:Zfp39 UTSW 11 58900589 missense probably damaging 0.97
R5697:Zfp39 UTSW 11 58889835 missense probably benign 0.08
R5906:Zfp39 UTSW 11 58902891 missense probably benign
R5925:Zfp39 UTSW 11 58891273 missense possibly damaging 0.94
R6174:Zfp39 UTSW 11 58891387 missense probably benign 0.01
R6177:Zfp39 UTSW 11 58891061 missense probably benign 0.27
R6968:Zfp39 UTSW 11 58891480 missense probably benign 0.00
R7045:Zfp39 UTSW 11 58890443 missense unknown
R7139:Zfp39 UTSW 11 58890559 missense probably damaging 1.00
R7421:Zfp39 UTSW 11 58890107 missense probably damaging 1.00
R7493:Zfp39 UTSW 11 58891043 missense possibly damaging 0.82
R7689:Zfp39 UTSW 11 58890643 missense probably damaging 1.00
R8136:Zfp39 UTSW 11 58891402 missense probably damaging 0.99
Z1186:Zfp39 UTSW 11 58890045 nonsense probably null
Z1186:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1186:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1186:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1186:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1186:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1186:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1186:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1186:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1186:Zfp39 UTSW 11 58891297 missense probably benign
Z1186:Zfp39 UTSW 11 58891316 missense probably benign
Z1186:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890045 nonsense probably null
Z1187:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1187:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1187:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1187:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1187:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1187:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1187:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1187:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1187:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1187:Zfp39 UTSW 11 58891297 missense probably benign
Z1187:Zfp39 UTSW 11 58891316 missense probably benign
Z1187:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890045 nonsense probably null
Z1188:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1188:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1188:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1188:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1188:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1188:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1188:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1188:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1188:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1188:Zfp39 UTSW 11 58891297 missense probably benign
Z1188:Zfp39 UTSW 11 58891316 missense probably benign
Z1188:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58890045 nonsense probably null
Z1189:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1189:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1189:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1189:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1189:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1189:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1189:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1189:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1189:Zfp39 UTSW 11 58891297 missense probably benign
Z1189:Zfp39 UTSW 11 58891316 missense probably benign
Z1189:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890045 nonsense probably null
Z1190:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1190:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1190:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1190:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1190:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1190:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1190:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1190:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1190:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1190:Zfp39 UTSW 11 58891297 missense probably benign
Z1190:Zfp39 UTSW 11 58891316 missense probably benign
Z1190:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890045 nonsense probably null
Z1191:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1191:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1191:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1191:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1191:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1191:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1191:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1191:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1191:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1191:Zfp39 UTSW 11 58891297 missense probably benign
Z1191:Zfp39 UTSW 11 58891316 missense probably benign
Z1191:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890045 nonsense probably null
Z1192:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1192:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1192:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1192:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1192:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1192:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1192:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1192:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1192:Zfp39 UTSW 11 58891297 missense probably benign
Z1192:Zfp39 UTSW 11 58891316 missense probably benign
Z1192:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAAGCACAATGTTGTATCTCTCC -3'
(R):5'- GCTTTATAGAGGAACTTGCAGCC -3'

Sequencing Primer
(F):5'- ATCTAACTCAGGTCGTCAGGACTG -3'
(R):5'- AACTTGCAGCCTGACAGTGTG -3'
Posted On2020-01-23