Incidental Mutation 'R8061:Vcan'
ID 619731
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Name versican
Synonyms PG-M, hdf, heart defect, Cspg2, DPEAAE, 5430420N07Rik
MMRRC Submission 067497-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8061 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 89803431-89890628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89805409 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 3336 (I3336L)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109543
AA Change: I637L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614
AA Change: I637L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
AA Change: I1597L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614
AA Change: I1597L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109546
AA Change: I3336L

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: I3336L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159285
SMART Domains Protein: ENSMUSP00000125674
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
CLECT 3 85 3.48e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
AA Change: I2376L

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614
AA Change: I2376L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160740
SMART Domains Protein: ENSMUSP00000125694
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
Pfam:Lectin_C 2 62 7.9e-7 PFAM
CCP 67 123 1.04e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads G A 5: 115,255,710 (GRCm39) R42C probably benign Het
Agrn G A 4: 156,263,411 (GRCm39) R338C probably damaging Het
Anapc1 T C 2: 128,490,408 (GRCm39) E1008G probably damaging Het
Art5 A T 7: 101,747,456 (GRCm39) Y108N possibly damaging Het
As3mt G A 19: 46,728,982 (GRCm39) C369Y probably damaging Het
Asb3 A G 11: 30,948,447 (GRCm39) N41S probably damaging Het
Astn1 G A 1: 158,331,920 (GRCm39) probably null Het
Asxl3 T A 18: 22,657,300 (GRCm39) M1770K possibly damaging Het
Atp8b2 T C 3: 89,853,527 (GRCm39) probably benign Het
Cfap300 A G 9: 8,042,672 (GRCm39) W37R probably damaging Het
Chrm1 T C 19: 8,656,518 (GRCm39) Y408H possibly damaging Het
Chst2 T C 9: 95,287,224 (GRCm39) H374R probably damaging Het
Cnot1 A G 8: 96,491,655 (GRCm39) F390L possibly damaging Het
Comt T C 16: 18,230,040 (GRCm39) Y100C probably benign Het
Cyria G T 12: 12,412,028 (GRCm39) A150S possibly damaging Het
Dclk2 T C 3: 86,720,981 (GRCm39) probably benign Het
Dicer1 G A 12: 104,669,077 (GRCm39) Q1202* probably null Het
Disp1 C T 1: 182,869,151 (GRCm39) V1090M probably damaging Het
Dnajc28 T C 16: 91,414,058 (GRCm39) D62G possibly damaging Het
Dock1 C T 7: 134,374,052 (GRCm39) T566I probably benign Het
Dop1a T G 9: 86,403,246 (GRCm39) M18R possibly damaging Het
Dop1b T C 16: 93,546,884 (GRCm39) L296P probably damaging Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Efcab3 A T 11: 104,997,275 (GRCm39) D155V probably benign Het
Ehmt2 T C 17: 35,124,903 (GRCm39) S465P possibly damaging Het
Eno1b G A 18: 48,180,725 (GRCm39) W301* probably null Het
Fpgt A G 3: 154,792,903 (GRCm39) S375P probably benign Het
Gas2l1 G A 11: 5,011,785 (GRCm39) S348F possibly damaging Het
Gen1 A T 12: 11,311,077 (GRCm39) probably benign Het
Ice1 A T 13: 70,751,851 (GRCm39) C1412S probably damaging Het
Iqcn A G 8: 71,161,224 (GRCm39) E139G probably benign Het
Klhl2 A C 8: 65,211,257 (GRCm39) L264V probably damaging Het
Lars2 A G 9: 123,288,562 (GRCm39) T803A probably benign Het
Ldb2 T A 5: 44,637,612 (GRCm39) K232M probably damaging Het
Lix1 G A 17: 17,663,938 (GRCm39) R92Q probably damaging Het
Meig1 C T 2: 3,410,240 (GRCm39) V87I not run Het
Mitf A C 6: 97,970,259 (GRCm39) S176R probably damaging Het
Myh7 A G 14: 55,228,398 (GRCm39) V236A probably benign Het
Myo5a T A 9: 75,030,239 (GRCm39) Y119* probably null Het
Ncapg2 A G 12: 116,390,197 (GRCm39) N382S probably benign Het
Neu2 C T 1: 87,524,633 (GRCm39) P206L probably damaging Het
Or2h2b-ps1 A G 17: 37,480,792 (GRCm39) F147S probably damaging Het
Osbpl5 C T 7: 143,256,461 (GRCm39) R454Q probably benign Het
Panx1 A G 9: 14,956,297 (GRCm39) S13P possibly damaging Het
Pde2a A G 7: 101,153,179 (GRCm39) D413G probably benign Het
Plcb1 A T 2: 135,188,316 (GRCm39) Y803F probably benign Het
Prrc2a T C 17: 35,380,162 (GRCm39) probably benign Het
Pth2r T A 1: 65,382,660 (GRCm39) Y143N possibly damaging Het
Ptpn4 C T 1: 119,619,330 (GRCm39) probably null Het
Rapgef3 T C 15: 97,659,401 (GRCm39) Y112C probably benign Het
Rusc2 A G 4: 43,422,492 (GRCm39) N907S probably damaging Het
Scn7a T A 2: 66,522,938 (GRCm39) N922I probably damaging Het
Shprh T C 10: 11,088,077 (GRCm39) V1620A possibly damaging Het
Slc25a54 T A 3: 109,018,361 (GRCm39) S280R probably damaging Het
Slc30a5 T C 13: 100,965,419 (GRCm39) I63M probably damaging Het
Smg1 A T 7: 117,751,610 (GRCm39) V2817E unknown Het
Sprr3 T C 3: 92,364,184 (GRCm39) E220G probably damaging Het
Tcf21 T C 10: 22,695,762 (GRCm39) E14G probably benign Het
Tenm4 A G 7: 96,501,663 (GRCm39) D1289G probably damaging Het
Tmem121b C A 6: 120,469,064 (GRCm39) G551V probably damaging Het
Tpk1 A G 6: 43,323,778 (GRCm39) S224P probably damaging Het
Trib1 T C 15: 59,523,404 (GRCm39) I146T probably damaging Het
Ttc32 T A 12: 9,084,953 (GRCm39) Y58N probably damaging Het
Vmn1r200 C A 13: 22,579,453 (GRCm39) Y85* probably null Het
Vps39 T C 2: 120,174,692 (GRCm39) I97V probably benign Het
Zan T A 5: 137,434,893 (GRCm39) I2167F unknown Het
Zfp37 A T 4: 62,109,665 (GRCm39) Y507* probably null Het
Zfp39 A G 11: 58,793,573 (GRCm39) V55A probably benign Het
Zfp616 A T 11: 73,974,340 (GRCm39) N294I possibly damaging Het
Zfp729a T C 13: 67,768,208 (GRCm39) T674A probably benign Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89,852,821 (GRCm39) missense probably damaging 1.00
IGL00502:Vcan APN 13 89,840,438 (GRCm39) missense probably benign
IGL00504:Vcan APN 13 89,839,394 (GRCm39) missense possibly damaging 0.70
IGL00566:Vcan APN 13 89,837,098 (GRCm39) missense probably benign 0.01
IGL00701:Vcan APN 13 89,851,845 (GRCm39) missense probably benign
IGL00743:Vcan APN 13 89,873,425 (GRCm39) missense probably damaging 0.98
IGL00962:Vcan APN 13 89,810,171 (GRCm39) missense probably damaging 1.00
IGL01085:Vcan APN 13 89,828,077 (GRCm39) missense probably damaging 1.00
IGL01317:Vcan APN 13 89,839,787 (GRCm39) missense probably benign 0.00
IGL01349:Vcan APN 13 89,852,062 (GRCm39) missense probably damaging 0.98
IGL01391:Vcan APN 13 89,852,288 (GRCm39) missense probably benign 0.19
IGL01644:Vcan APN 13 89,836,794 (GRCm39) missense probably benign 0.13
IGL01657:Vcan APN 13 89,838,705 (GRCm39) missense probably damaging 1.00
IGL01707:Vcan APN 13 89,837,864 (GRCm39) missense probably damaging 1.00
IGL01764:Vcan APN 13 89,873,507 (GRCm39) missense probably damaging 1.00
IGL01920:Vcan APN 13 89,837,324 (GRCm39) missense probably benign 0.04
IGL01989:Vcan APN 13 89,837,478 (GRCm39) missense possibly damaging 0.86
IGL01999:Vcan APN 13 89,832,557 (GRCm39) missense probably damaging 1.00
IGL02083:Vcan APN 13 89,873,684 (GRCm39) missense probably damaging 1.00
IGL02160:Vcan APN 13 89,832,612 (GRCm39) missense probably damaging 1.00
IGL02217:Vcan APN 13 89,851,196 (GRCm39) missense probably damaging 1.00
IGL02522:Vcan APN 13 89,852,968 (GRCm39) missense probably benign 0.00
IGL02527:Vcan APN 13 89,838,776 (GRCm39) missense possibly damaging 0.95
IGL02926:Vcan APN 13 89,836,742 (GRCm39) missense probably damaging 0.98
IGL03061:Vcan APN 13 89,851,394 (GRCm39) missense probably benign 0.25
IGL03331:Vcan APN 13 89,810,051 (GRCm39) missense probably damaging 1.00
IGL03352:Vcan APN 13 89,853,125 (GRCm39) missense probably benign 0.00
R0041:Vcan UTSW 13 89,810,104 (GRCm39) missense probably damaging 1.00
R0102:Vcan UTSW 13 89,851,787 (GRCm39) missense probably benign 0.01
R0102:Vcan UTSW 13 89,851,787 (GRCm39) missense probably benign 0.01
R0109:Vcan UTSW 13 89,826,192 (GRCm39) critical splice donor site probably null
R0139:Vcan UTSW 13 89,839,380 (GRCm39) missense probably damaging 1.00
R0295:Vcan UTSW 13 89,860,310 (GRCm39) missense probably benign 0.06
R0375:Vcan UTSW 13 89,839,394 (GRCm39) missense probably damaging 0.99
R0379:Vcan UTSW 13 89,851,665 (GRCm39) missense probably damaging 0.99
R0457:Vcan UTSW 13 89,851,318 (GRCm39) missense possibly damaging 0.78
R0482:Vcan UTSW 13 89,826,264 (GRCm39) missense probably damaging 1.00
R0485:Vcan UTSW 13 89,852,779 (GRCm39) missense possibly damaging 0.92
R0532:Vcan UTSW 13 89,851,891 (GRCm39) missense probably damaging 0.99
R0561:Vcan UTSW 13 89,879,583 (GRCm39) missense possibly damaging 0.86
R0561:Vcan UTSW 13 89,860,372 (GRCm39) missense probably damaging 1.00
R0636:Vcan UTSW 13 89,860,386 (GRCm39) missense probably damaging 1.00
R0636:Vcan UTSW 13 89,852,825 (GRCm39) missense probably damaging 0.99
R0680:Vcan UTSW 13 89,827,941 (GRCm39) missense probably damaging 1.00
R0849:Vcan UTSW 13 89,853,072 (GRCm39) missense possibly damaging 0.75
R1006:Vcan UTSW 13 89,833,196 (GRCm39) critical splice donor site probably null
R1104:Vcan UTSW 13 89,840,529 (GRCm39) missense probably damaging 1.00
R1118:Vcan UTSW 13 89,853,782 (GRCm39) missense probably damaging 1.00
R1137:Vcan UTSW 13 89,852,422 (GRCm39) missense probably damaging 1.00
R1199:Vcan UTSW 13 89,827,913 (GRCm39) splice site probably null
R1219:Vcan UTSW 13 89,828,023 (GRCm39) missense probably damaging 1.00
R1296:Vcan UTSW 13 89,805,675 (GRCm39) missense probably damaging 1.00
R1332:Vcan UTSW 13 89,841,174 (GRCm39) missense probably damaging 1.00
R1336:Vcan UTSW 13 89,841,174 (GRCm39) missense probably damaging 1.00
R1403:Vcan UTSW 13 89,836,603 (GRCm39) missense probably benign 0.00
R1403:Vcan UTSW 13 89,836,603 (GRCm39) missense probably benign 0.00
R1546:Vcan UTSW 13 89,841,075 (GRCm39) missense probably damaging 0.99
R1604:Vcan UTSW 13 89,837,780 (GRCm39) missense probably benign 0.42
R1616:Vcan UTSW 13 89,853,782 (GRCm39) missense probably damaging 1.00
R1636:Vcan UTSW 13 89,851,786 (GRCm39) missense possibly damaging 0.90
R1654:Vcan UTSW 13 89,810,065 (GRCm39) missense probably damaging 1.00
R1680:Vcan UTSW 13 89,851,666 (GRCm39) missense probably benign 0.19
R1694:Vcan UTSW 13 89,836,602 (GRCm39) missense probably damaging 0.98
R1712:Vcan UTSW 13 89,869,894 (GRCm39) missense probably damaging 1.00
R1754:Vcan UTSW 13 89,852,854 (GRCm39) missense probably benign 0.01
R1756:Vcan UTSW 13 89,839,800 (GRCm39) missense probably benign 0.05
R1824:Vcan UTSW 13 89,853,331 (GRCm39) missense possibly damaging 0.75
R1852:Vcan UTSW 13 89,853,511 (GRCm39) missense probably damaging 0.99
R1868:Vcan UTSW 13 89,838,990 (GRCm39) missense probably benign 0.12
R1920:Vcan UTSW 13 89,841,134 (GRCm39) missense probably damaging 1.00
R1932:Vcan UTSW 13 89,853,653 (GRCm39) missense possibly damaging 0.78
R1934:Vcan UTSW 13 89,851,045 (GRCm39) missense probably damaging 1.00
R1942:Vcan UTSW 13 89,851,543 (GRCm39) missense probably benign 0.01
R1964:Vcan UTSW 13 89,840,861 (GRCm39) missense probably benign 0.02
R1970:Vcan UTSW 13 89,837,157 (GRCm39) missense probably damaging 1.00
R2045:Vcan UTSW 13 89,839,104 (GRCm39) missense probably benign 0.00
R2110:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2111:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2112:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2136:Vcan UTSW 13 89,837,856 (GRCm39) missense probably damaging 1.00
R2158:Vcan UTSW 13 89,851,648 (GRCm39) missense possibly damaging 0.68
R2376:Vcan UTSW 13 89,851,529 (GRCm39) missense possibly damaging 0.80
R2385:Vcan UTSW 13 89,837,568 (GRCm39) missense probably damaging 1.00
R2443:Vcan UTSW 13 89,852,794 (GRCm39) missense probably damaging 1.00
R2876:Vcan UTSW 13 89,852,356 (GRCm39) missense probably damaging 1.00
R3607:Vcan UTSW 13 89,851,420 (GRCm39) missense probably damaging 0.98
R4042:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4043:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4044:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4065:Vcan UTSW 13 89,828,006 (GRCm39) missense probably damaging 1.00
R4161:Vcan UTSW 13 89,833,277 (GRCm39) missense probably damaging 1.00
R4178:Vcan UTSW 13 89,873,666 (GRCm39) missense probably damaging 1.00
R4290:Vcan UTSW 13 89,873,605 (GRCm39) missense probably damaging 1.00
R4530:Vcan UTSW 13 89,852,147 (GRCm39) missense probably damaging 0.97
R4666:Vcan UTSW 13 89,828,053 (GRCm39) missense probably damaging 1.00
R4785:Vcan UTSW 13 89,853,908 (GRCm39) missense probably damaging 1.00
R4870:Vcan UTSW 13 89,852,858 (GRCm39) missense probably benign 0.01
R4973:Vcan UTSW 13 89,836,961 (GRCm39) missense probably benign 0.30
R5037:Vcan UTSW 13 89,852,096 (GRCm39) missense probably damaging 1.00
R5104:Vcan UTSW 13 89,805,591 (GRCm39) intron probably benign
R5124:Vcan UTSW 13 89,873,636 (GRCm39) missense probably damaging 1.00
R5129:Vcan UTSW 13 89,838,359 (GRCm39) missense probably damaging 1.00
R5198:Vcan UTSW 13 89,838,991 (GRCm39) missense probably damaging 1.00
R5240:Vcan UTSW 13 89,840,651 (GRCm39) missense probably benign 0.08
R5254:Vcan UTSW 13 89,839,719 (GRCm39) missense probably damaging 0.99
R5280:Vcan UTSW 13 89,838,405 (GRCm39) missense probably benign 0.00
R5522:Vcan UTSW 13 89,839,929 (GRCm39) missense possibly damaging 0.62
R5557:Vcan UTSW 13 89,851,231 (GRCm39) missense possibly damaging 0.77
R5568:Vcan UTSW 13 89,836,790 (GRCm39) missense probably damaging 1.00
R5578:Vcan UTSW 13 89,839,622 (GRCm39) missense probably benign 0.01
R5627:Vcan UTSW 13 89,839,254 (GRCm39) frame shift probably null
R5687:Vcan UTSW 13 89,826,253 (GRCm39) missense probably damaging 1.00
R5752:Vcan UTSW 13 89,828,069 (GRCm39) missense probably damaging 1.00
R5879:Vcan UTSW 13 89,852,071 (GRCm39) missense probably damaging 0.99
R5941:Vcan UTSW 13 89,840,810 (GRCm39) missense probably damaging 0.98
R6113:Vcan UTSW 13 89,805,655 (GRCm39) nonsense probably null
R6135:Vcan UTSW 13 89,838,045 (GRCm39) missense probably benign 0.36
R6252:Vcan UTSW 13 89,839,339 (GRCm39) nonsense probably null
R6280:Vcan UTSW 13 89,873,492 (GRCm39) missense probably damaging 1.00
R6317:Vcan UTSW 13 89,839,716 (GRCm39) missense probably benign 0.22
R6327:Vcan UTSW 13 89,852,951 (GRCm39) missense probably damaging 0.99
R6460:Vcan UTSW 13 89,838,806 (GRCm39) missense possibly damaging 0.61
R6669:Vcan UTSW 13 89,852,850 (GRCm39) missense probably benign 0.21
R6744:Vcan UTSW 13 89,853,301 (GRCm39) missense probably damaging 1.00
R6819:Vcan UTSW 13 89,853,244 (GRCm39) missense probably benign 0.00
R6880:Vcan UTSW 13 89,860,500 (GRCm39) missense probably damaging 1.00
R6956:Vcan UTSW 13 89,837,550 (GRCm39) missense probably damaging 0.99
R6971:Vcan UTSW 13 89,826,252 (GRCm39) missense probably damaging 1.00
R6985:Vcan UTSW 13 89,828,075 (GRCm39) missense probably damaging 1.00
R6994:Vcan UTSW 13 89,841,526 (GRCm39) missense possibly damaging 0.94
R6997:Vcan UTSW 13 89,838,737 (GRCm39) missense probably damaging 0.98
R7029:Vcan UTSW 13 89,838,360 (GRCm39) missense probably damaging 1.00
R7066:Vcan UTSW 13 89,853,805 (GRCm39) missense probably damaging 1.00
R7156:Vcan UTSW 13 89,837,229 (GRCm39) missense possibly damaging 0.95
R7171:Vcan UTSW 13 89,873,710 (GRCm39) missense probably damaging 1.00
R7176:Vcan UTSW 13 89,837,055 (GRCm39) missense probably benign 0.01
R7229:Vcan UTSW 13 89,853,389 (GRCm39) missense possibly damaging 0.87
R7250:Vcan UTSW 13 89,879,576 (GRCm39) critical splice donor site probably null
R7250:Vcan UTSW 13 89,869,805 (GRCm39) missense probably damaging 1.00
R7262:Vcan UTSW 13 89,853,280 (GRCm39) missense possibly damaging 0.62
R7289:Vcan UTSW 13 89,840,852 (GRCm39) nonsense probably null
R7299:Vcan UTSW 13 89,853,385 (GRCm39) missense probably benign
R7301:Vcan UTSW 13 89,853,385 (GRCm39) missense probably benign
R7425:Vcan UTSW 13 89,837,951 (GRCm39) missense probably damaging 0.99
R7514:Vcan UTSW 13 89,852,237 (GRCm39) missense probably damaging 0.97
R7579:Vcan UTSW 13 89,840,577 (GRCm39) missense probably damaging 1.00
R7618:Vcan UTSW 13 89,840,342 (GRCm39) missense probably damaging 0.99
R7655:Vcan UTSW 13 89,833,233 (GRCm39) missense probably damaging 1.00
R7656:Vcan UTSW 13 89,833,233 (GRCm39) missense probably damaging 1.00
R7676:Vcan UTSW 13 89,839,908 (GRCm39) missense probably damaging 1.00
R7719:Vcan UTSW 13 89,852,738 (GRCm39) missense probably damaging 0.98
R7753:Vcan UTSW 13 89,837,442 (GRCm39) missense probably damaging 1.00
R7762:Vcan UTSW 13 89,841,056 (GRCm39) missense probably damaging 1.00
R7778:Vcan UTSW 13 89,836,773 (GRCm39) missense probably damaging 1.00
R7824:Vcan UTSW 13 89,836,773 (GRCm39) missense probably damaging 1.00
R7995:Vcan UTSW 13 89,839,977 (GRCm39) missense probably benign
R7998:Vcan UTSW 13 89,852,446 (GRCm39) missense probably damaging 1.00
R8033:Vcan UTSW 13 89,852,479 (GRCm39) missense probably benign 0.04
R8103:Vcan UTSW 13 89,851,439 (GRCm39) nonsense probably null
R8103:Vcan UTSW 13 89,805,777 (GRCm39) missense probably damaging 1.00
R8124:Vcan UTSW 13 89,852,373 (GRCm39) missense possibly damaging 0.93
R8162:Vcan UTSW 13 89,853,106 (GRCm39) nonsense probably null
R8166:Vcan UTSW 13 89,840,855 (GRCm39) missense probably benign 0.02
R8274:Vcan UTSW 13 89,853,089 (GRCm39) missense probably benign 0.02
R8284:Vcan UTSW 13 89,852,454 (GRCm39) missense possibly damaging 0.68
R8417:Vcan UTSW 13 89,836,862 (GRCm39) missense probably benign 0.19
R8696:Vcan UTSW 13 89,839,217 (GRCm39) missense probably benign 0.00
R8738:Vcan UTSW 13 89,840,439 (GRCm39) missense probably benign 0.17
R8792:Vcan UTSW 13 89,840,230 (GRCm39) missense possibly damaging 0.91
R8887:Vcan UTSW 13 89,853,026 (GRCm39) missense probably benign
R9049:Vcan UTSW 13 89,826,224 (GRCm39) missense probably damaging 1.00
R9074:Vcan UTSW 13 89,839,146 (GRCm39) missense possibly damaging 0.95
R9095:Vcan UTSW 13 89,852,644 (GRCm39) missense probably benign 0.32
R9172:Vcan UTSW 13 89,828,050 (GRCm39) missense probably damaging 1.00
R9199:Vcan UTSW 13 89,838,615 (GRCm39) nonsense probably null
R9259:Vcan UTSW 13 89,838,989 (GRCm39) missense probably damaging 0.99
R9455:Vcan UTSW 13 89,837,452 (GRCm39) missense probably damaging 1.00
R9476:Vcan UTSW 13 89,851,531 (GRCm39) missense possibly damaging 0.95
R9477:Vcan UTSW 13 89,841,128 (GRCm39) missense probably damaging 1.00
R9555:Vcan UTSW 13 89,839,659 (GRCm39) missense
R9579:Vcan UTSW 13 89,837,713 (GRCm39) missense possibly damaging 0.67
R9606:Vcan UTSW 13 89,853,491 (GRCm39) missense probably damaging 1.00
R9645:Vcan UTSW 13 89,841,081 (GRCm39) missense probably benign 0.00
R9659:Vcan UTSW 13 89,839,860 (GRCm39) missense probably damaging 0.99
R9766:Vcan UTSW 13 89,839,247 (GRCm39) missense probably benign 0.00
R9778:Vcan UTSW 13 89,837,930 (GRCm39) missense probably damaging 1.00
X0058:Vcan UTSW 13 89,840,612 (GRCm39) missense probably benign 0.21
X0065:Vcan UTSW 13 89,853,868 (GRCm39) missense probably damaging 0.96
Z1176:Vcan UTSW 13 89,840,690 (GRCm39) missense probably benign 0.10
Z1177:Vcan UTSW 13 89,852,192 (GRCm39) missense probably damaging 1.00
Z1177:Vcan UTSW 13 89,851,907 (GRCm39) nonsense probably null
Z1177:Vcan UTSW 13 89,851,643 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATTTTAAGAGTACAGCCACCCC -3'
(R):5'- CGGACAGCGTTGCTTTAACAG -3'

Sequencing Primer
(F):5'- TTTTAAGAGTACAGCCACCCCAAATG -3'
(R):5'- CGTTGCTTTAACAGATACTAGACACC -3'
Posted On 2020-01-23