Mutagenetix > Incidental Mutation

Incidental Mutation 'R8061:Slc30a5'

619732

Institutional Source

Beutler Lab

Gene Symbol

Slc30a5

Ensembl Gene

ENSMUSG00000021629

Gene Name

solute carrier family 30 (zinc transporter), member 5

Synonyms

Zntl1, Znt5, 1810010K08Rik, ZTL1, ZnT-5

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.690) question?

Stock #

R8061 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100802648-100833427 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100828911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 63 (I63M)

Ref Sequence

ENSEMBL: ENSMUSP00000065764 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067246] [ENSMUST00000225922]

AlphaFold

Q8R4H9

Predicted Effect

probably damaging
Transcript: ENSMUST00000067246
AA Change: I63M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000065764
Gene: ENSMUSG00000021629
AA Change: I63M

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
transmembrane domain	56	75	N/A	INTRINSIC
transmembrane domain	96	113	N/A	INTRINSIC
transmembrane domain	128	145	N/A	INTRINSIC
transmembrane domain	150	164	N/A	INTRINSIC
transmembrane domain	192	214	N/A	INTRINSIC
transmembrane domain	235	254	N/A	INTRINSIC
transmembrane domain	264	286	N/A	INTRINSIC
transmembrane domain	299	321	N/A	INTRINSIC
transmembrane domain	341	360	N/A	INTRINSIC
Pfam:Cation_efflux	417	645	1.9e-50	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000225922
AA Change: I63M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Meta Mutation Damage Score

0.0864

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are growth retarded and exhibit skeletal defects including reduced bone density. The majority of mutant male mice die suddenly when they reach reproductive age due to bradyarrhythmia, whereas female mice live a normal term. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	A	G	9: 8,042,671	W37R	probably damaging	Het
Acads	G	A	5: 115,117,651	R42C	probably benign	Het
Agrn	G	A	4: 156,178,954	R338C	probably damaging	Het
Anapc1	T	C	2: 128,648,488	E1008G	probably damaging	Het
Art5	A	T	7: 102,098,249	Y108N	possibly damaging	Het
As3mt	G	A	19: 46,740,543	C369Y	probably damaging	Het
Asb3	A	G	11: 30,998,447	N41S	probably damaging	Het
Astn1	G	A	1: 158,504,350		probably null	Het
Asxl3	T	A	18: 22,524,243	M1770K	possibly damaging	Het
Atp8b2	T	C	3: 89,946,220		probably benign	Het
Chrm1	T	C	19: 8,679,154	Y408H	possibly damaging	Het
Chst2	T	C	9: 95,405,171	H374R	probably damaging	Het
Cnot1	A	G	8: 95,765,027	F390L	possibly damaging	Het
Comt	T	C	16: 18,411,290	Y100C	probably benign	Het
Dclk2	T	C	3: 86,813,674		probably benign	Het
Dicer1	G	A	12: 104,702,818	Q1202*	probably null	Het
Disp1	C	T	1: 183,087,587	V1090M	probably damaging	Het
Dnajc28	T	C	16: 91,617,170	D62G	possibly damaging	Het
Dock1	C	T	7: 134,772,323	T566I	probably benign	Het
Dopey1	T	G	9: 86,521,193	M18R	possibly damaging	Het
Dopey2	T	C	16: 93,749,996	L296P	probably damaging	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab3	A	T	11: 105,106,449	D155V	probably benign	Het
Ehmt2	T	C	17: 34,905,927	S465P	possibly damaging	Het
Eno1b	G	A	18: 48,047,658	W301*	probably null	Het
Fam49a	G	T	12: 12,362,027	A150S	possibly damaging	Het
Fpgt	A	G	3: 155,087,266	S375P	probably benign	Het
Gas2l1	G	A	11: 5,061,785	S348F	possibly damaging	Het
Gen1	A	T	12: 11,261,076		probably benign	Het
Gm16486	A	G	8: 70,708,575	E139G	probably benign	Het
Ice1	A	T	13: 70,603,732	C1412S	probably damaging	Het
Klhl2	A	C	8: 64,758,223	L264V	probably damaging	Het
Lars2	A	G	9: 123,459,497	T803A	probably benign	Het
Ldb2	T	A	5: 44,480,270	K232M	probably damaging	Het
Lix1	G	A	17: 17,443,676	R92Q	probably damaging	Het
Meig1	C	T	2: 3,409,203	V87I	not run	Het
Mitf	A	C	6: 97,993,298	S176R	probably damaging	Het
Myh7	A	G	14: 54,990,941	V236A	probably benign	Het
Myo5a	T	A	9: 75,122,957	Y119*	probably null	Het
Ncapg2	A	G	12: 116,426,577	N382S	probably benign	Het
Neu2	C	T	1: 87,596,911	P206L	probably damaging	Het
Olfr753-ps1	A	G	17: 37,169,901	F147S	probably damaging	Het
Osbpl5	C	T	7: 143,702,724	R454Q	probably benign	Het
Panx1	A	G	9: 15,045,001	S13P	possibly damaging	Het
Pde2a	A	G	7: 101,503,972	D413G	probably benign	Het
Plcb1	A	T	2: 135,346,396	Y803F	probably benign	Het
Prrc2a	T	C	17: 35,161,186		probably benign	Het
Pth2r	T	A	1: 65,343,501	Y143N	possibly damaging	Het
Ptpn4	C	T	1: 119,691,600		probably null	Het
Rapgef3	T	C	15: 97,761,520	Y112C	probably benign	Het
Rusc2	A	G	4: 43,422,492	N907S	probably damaging	Het
Scn7a	T	A	2: 66,692,594	N922I	probably damaging	Het
Shprh	T	C	10: 11,212,333	V1620A	possibly damaging	Het
Slc25a54	T	A	3: 109,111,045	S280R	probably damaging	Het
Smg1	A	T	7: 118,152,387	V2817E	unknown	Het
Sprr3	T	C	3: 92,456,877	E220G	probably damaging	Het
Tcf21	T	C	10: 22,819,863	E14G	probably benign	Het
Tenm4	A	G	7: 96,852,456	D1289G	probably damaging	Het
Tmem121b	C	A	6: 120,492,103	G551V	probably damaging	Het
Tpk1	A	G	6: 43,346,844	S224P	probably damaging	Het
Trib1	T	C	15: 59,651,555	I146T	probably damaging	Het
Ttc32	T	A	12: 9,034,953	Y58N	probably damaging	Het
Vcan	T	A	13: 89,657,290	I3336L	probably benign	Het
Vmn1r200	C	A	13: 22,395,283	Y85*	probably null	Het
Vps39	T	C	2: 120,344,211	I97V	probably benign	Het
Zan	T	A	5: 137,436,631	I2167F	unknown	Het
Zfp37	A	T	4: 62,191,428	Y507*	probably null	Het
Zfp39	A	G	11: 58,902,747	V55A	probably benign	Het
Zfp616	A	T	11: 74,083,514	N294I	possibly damaging	Het
Zfp729a	T	C	13: 67,620,089	T674A	probably benign	Het

Other mutations in Slc30a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Slc30a5	APN	13	100806666	missense	probably damaging	1.00
IGL01647:Slc30a5	APN	13	100821145	missense	possibly damaging	0.66
IGL02338:Slc30a5	APN	13	100803433	missense	probably damaging	0.99
IGL02408:Slc30a5	APN	13	100813724	missense	probably damaging	1.00
IGL02582:Slc30a5	APN	13	100812647	critical splice donor site	probably null
IGL02987:Slc30a5	APN	13	100803915	missense	probably damaging	1.00
IGL03025:Slc30a5	APN	13	100813887	missense	probably damaging	0.99
IGL03064:Slc30a5	APN	13	100811310	missense	probably damaging	1.00
IGL03089:Slc30a5	APN	13	100813830	missense	probably benign	0.01
IGL03268:Slc30a5	APN	13	100806703	missense	probably damaging	1.00
R0083:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0108:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0108:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0153:Slc30a5	UTSW	13	100826494	missense	possibly damaging	0.46
R0542:Slc30a5	UTSW	13	100809285	splice site	probably null
R0601:Slc30a5	UTSW	13	100814770	intron	probably benign
R1125:Slc30a5	UTSW	13	100803413	missense	probably damaging	1.00
R1434:Slc30a5	UTSW	13	100803442	missense	probably damaging	0.98
R1673:Slc30a5	UTSW	13	100813383	missense	probably benign	0.13
R1762:Slc30a5	UTSW	13	100813462	missense	probably damaging	1.00
R1974:Slc30a5	UTSW	13	100813953	missense	probably benign	0.06
R2082:Slc30a5	UTSW	13	100806533	critical splice donor site	probably null
R2151:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R2152:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R2153:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R3899:Slc30a5	UTSW	13	100818147	missense	probably benign	0.18
R4009:Slc30a5	UTSW	13	100809233	missense	probably damaging	1.00
R4010:Slc30a5	UTSW	13	100809233	missense	probably damaging	1.00
R4270:Slc30a5	UTSW	13	100829013	missense	probably benign	0.04
R4815:Slc30a5	UTSW	13	100813710	missense	probably damaging	1.00
R5048:Slc30a5	UTSW	13	100806741	missense	probably damaging	1.00
R5450:Slc30a5	UTSW	13	100821172	missense	possibly damaging	0.81
R5638:Slc30a5	UTSW	13	100813872	nonsense	probably null
R5892:Slc30a5	UTSW	13	100813302	missense	probably damaging	1.00
R5911:Slc30a5	UTSW	13	100809092	missense	probably damaging	1.00
R6453:Slc30a5	UTSW	13	100814689	missense	probably benign	0.00
R6769:Slc30a5	UTSW	13	100813860	missense	probably benign	0.19
R6795:Slc30a5	UTSW	13	100817069	missense	probably damaging	1.00
R7020:Slc30a5	UTSW	13	100824913	splice site	probably null
R7224:Slc30a5	UTSW	13	100809254	missense	probably damaging	0.99
R7305:Slc30a5	UTSW	13	100811424	missense	probably damaging	0.98
R7318:Slc30a5	UTSW	13	100813969	missense	probably benign	0.13
R7411:Slc30a5	UTSW	13	100818180	missense	probably benign	0.15
R7563:Slc30a5	UTSW	13	100803972	missense	probably benign	0.30
R8039:Slc30a5	UTSW	13	100813681	critical splice donor site	probably null
R8973:Slc30a5	UTSW	13	100806694	missense	probably damaging	0.99
R9150:Slc30a5	UTSW	13	100803407	nonsense	probably null
R9352:Slc30a5	UTSW	13	100803872	missense	probably benign	0.10
R9359:Slc30a5	UTSW	13	100813462	missense	probably damaging	1.00
R9405:Slc30a5	UTSW	13	100813908	missense	probably benign	0.00
R9407:Slc30a5	UTSW	13	100814706	nonsense	probably null
R9628:Slc30a5	UTSW	13	100824914	critical splice donor site	probably null
X0019:Slc30a5	UTSW	13	100813842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGTCAGAAGAAATAAACTTCAC -3'
(R):5'- AGCAGTAGTTAACATGTGGATGGTG -3'

Sequencing Primer
(F):5'- GTGCACACCTTTAATCCCAGC -3'
(R):5'- AACATGTGGATGGTGGGTTG -3'

Posted On

2020-01-23