Incidental Mutation 'R8061:Trib1'
ID619734
Institutional Source Beutler Lab
Gene Symbol Trib1
Ensembl Gene ENSMUSG00000032501
Gene Nametribbles pseudokinase 1
SynonymsTrb1, A530090O15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8061 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location59648350-59657099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59651555 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 146 (I146T)
Ref Sequence ENSEMBL: ENSMUSP00000068834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067543] [ENSMUST00000118228]
Predicted Effect probably damaging
Transcript: ENSMUST00000067543
AA Change: I146T

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068834
Gene: ENSMUSG00000032501
AA Change: I146T

DomainStartEndE-ValueType
low complexity region 61 82 N/A INTRINSIC
Pfam:Pkinase 105 338 1.1e-33 PFAM
Pfam:Pkinase_Tyr 120 335 2.1e-15 PFAM
Pfam:Kinase-like 124 326 1.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118228
AA Change: I146T

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112828
Gene: ENSMUSG00000032501
AA Change: I146T

DomainStartEndE-ValueType
low complexity region 61 82 N/A INTRINSIC
Pfam:Pkinase 104 218 7.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Macrophages from mice homozygous for a knock-out allele exhibit impaired IL12 response to LPS, MALP-1, or CpG DNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A G 9: 8,042,671 W37R probably damaging Het
Acads G A 5: 115,117,651 R42C probably benign Het
Agrn G A 4: 156,178,954 R338C probably damaging Het
Anapc1 T C 2: 128,648,488 E1008G probably damaging Het
Art5 A T 7: 102,098,249 Y108N possibly damaging Het
As3mt G A 19: 46,740,543 C369Y probably damaging Het
Asb3 A G 11: 30,998,447 N41S probably damaging Het
Astn1 G A 1: 158,504,350 probably null Het
Asxl3 T A 18: 22,524,243 M1770K possibly damaging Het
Chrm1 T C 19: 8,679,154 Y408H possibly damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cnot1 A G 8: 95,765,027 F390L possibly damaging Het
Comt T C 16: 18,411,290 Y100C probably benign Het
Dicer1 G A 12: 104,702,818 Q1202* probably null Het
Disp1 C T 1: 183,087,587 V1090M probably damaging Het
Dnajc28 T C 16: 91,617,170 D62G possibly damaging Het
Dock1 C T 7: 134,772,323 T566I probably benign Het
Dopey1 T G 9: 86,521,193 M18R possibly damaging Het
Dopey2 T C 16: 93,749,996 L296P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab3 A T 11: 105,106,449 D155V probably benign Het
Ehmt2 T C 17: 34,905,927 S465P possibly damaging Het
Eno1b G A 18: 48,047,658 W301* probably null Het
Fam49a G T 12: 12,362,027 A150S possibly damaging Het
Fpgt A G 3: 155,087,266 S375P probably benign Het
Gas2l1 G A 11: 5,061,785 S348F possibly damaging Het
Gm16486 A G 8: 70,708,575 E139G probably benign Het
Ice1 A T 13: 70,603,732 C1412S probably damaging Het
Klhl2 A C 8: 64,758,223 L264V probably damaging Het
Lars2 A G 9: 123,459,497 T803A probably benign Het
Ldb2 T A 5: 44,480,270 K232M probably damaging Het
Lix1 G A 17: 17,443,676 R92Q probably damaging Het
Meig1 C T 2: 3,409,203 V87I not run Het
Mitf A C 6: 97,993,298 S176R probably damaging Het
Myh7 A G 14: 54,990,941 V236A probably benign Het
Myo5a T A 9: 75,122,957 Y119* probably null Het
Ncapg2 A G 12: 116,426,577 N382S probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr753-ps1 A G 17: 37,169,901 F147S probably damaging Het
Osbpl5 C T 7: 143,702,724 R454Q probably benign Het
Panx1 A G 9: 15,045,001 S13P possibly damaging Het
Pde2a A G 7: 101,503,972 D413G probably benign Het
Plcb1 A T 2: 135,346,396 Y803F probably benign Het
Pth2r T A 1: 65,343,501 Y143N possibly damaging Het
Ptpn4 C T 1: 119,691,600 probably null Het
Rapgef3 T C 15: 97,761,520 Y112C probably benign Het
Rusc2 A G 4: 43,422,492 N907S probably damaging Het
Scn7a T A 2: 66,692,594 N922I probably damaging Het
Shprh T C 10: 11,212,333 V1620A possibly damaging Het
Slc25a54 T A 3: 109,111,045 S280R probably damaging Het
Slc30a5 T C 13: 100,828,911 I63M probably damaging Het
Smg1 A T 7: 118,152,387 V2817E unknown Het
Sprr3 T C 3: 92,456,877 E220G probably damaging Het
Tcf21 T C 10: 22,819,863 E14G probably benign Het
Tenm4 A G 7: 96,852,456 D1289G probably damaging Het
Tmem121b C A 6: 120,492,103 G551V probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Ttc32 T A 12: 9,034,953 Y58N probably damaging Het
Vcan T A 13: 89,657,290 I3336L probably benign Het
Vmn1r200 C A 13: 22,395,283 Y85* probably null Het
Vps39 T C 2: 120,344,211 I97V probably benign Het
Zan T A 5: 137,436,631 I2167F unknown Het
Zfp37 A T 4: 62,191,428 Y507* probably null Het
Zfp39 A G 11: 58,902,747 V55A probably benign Het
Zfp616 A T 11: 74,083,514 N294I possibly damaging Het
Zfp729a T C 13: 67,620,089 T674A probably benign Het
Other mutations in Trib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Trib1 APN 15 59651627 missense probably damaging 1.00
IGL01648:Trib1 APN 15 59654501 missense probably benign 0.38
IGL02267:Trib1 APN 15 59651600 missense probably damaging 0.98
IGL03018:Trib1 APN 15 59654484 missense probably damaging 1.00
topcat UTSW 15 59651638 nonsense probably null
R1994:Trib1 UTSW 15 59649343 missense possibly damaging 0.70
R2073:Trib1 UTSW 15 59654340 missense probably damaging 1.00
R2407:Trib1 UTSW 15 59654600 missense probably benign 0.00
R3709:Trib1 UTSW 15 59654361 missense probably damaging 1.00
R5759:Trib1 UTSW 15 59654501 missense probably benign
R5986:Trib1 UTSW 15 59654602 unclassified probably null
R6083:Trib1 UTSW 15 59654475 missense probably damaging 1.00
R6084:Trib1 UTSW 15 59654475 missense probably damaging 1.00
R6086:Trib1 UTSW 15 59654475 missense probably damaging 1.00
R6112:Trib1 UTSW 15 59651638 nonsense probably null
R6113:Trib1 UTSW 15 59651638 nonsense probably null
R6316:Trib1 UTSW 15 59649415 missense probably benign
R7288:Trib1 UTSW 15 59654622 missense probably benign
R7663:Trib1 UTSW 15 59651713 missense probably damaging 1.00
R7744:Trib1 UTSW 15 59654663 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCATTGAAAGCCCAAAGATG -3'
(R):5'- TGTTCCAAAAGGCCACCAGAAG -3'

Sequencing Primer
(F):5'- TTCTCCCCACAGGAATTC -3'
(R):5'- GACGAACTTCCTGAGCTTCAG -3'
Posted On2020-01-23