Incidental Mutation 'R8061:Dopey2'
ID619738
Institutional Source Beutler Lab
Gene Symbol Dopey2
Ensembl Gene ENSMUSG00000022946
Gene Namedopey family member 2
Synonyms0610038M01Rik, 2610510B01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8061 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location93711904-93810590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93749996 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 296 (L296P)
Ref Sequence ENSEMBL: ENSMUSP00000044437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]
Predicted Effect probably damaging
Transcript: ENSMUST00000045004
AA Change: L296P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: L296P

DomainStartEndE-ValueType
Pfam:Dopey_N 11 308 3.9e-104 PFAM
low complexity region 651 666 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 747 759 N/A INTRINSIC
low complexity region 1186 1199 N/A INTRINSIC
low complexity region 1436 1451 N/A INTRINSIC
low complexity region 1893 1908 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227156
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A G 9: 8,042,671 W37R probably damaging Het
Acads G A 5: 115,117,651 R42C probably benign Het
Agrn G A 4: 156,178,954 R338C probably damaging Het
Anapc1 T C 2: 128,648,488 E1008G probably damaging Het
Art5 A T 7: 102,098,249 Y108N possibly damaging Het
As3mt G A 19: 46,740,543 C369Y probably damaging Het
Asb3 A G 11: 30,998,447 N41S probably damaging Het
Astn1 G A 1: 158,504,350 probably null Het
Asxl3 T A 18: 22,524,243 M1770K possibly damaging Het
Chrm1 T C 19: 8,679,154 Y408H possibly damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cnot1 A G 8: 95,765,027 F390L possibly damaging Het
Comt T C 16: 18,411,290 Y100C probably benign Het
Dicer1 G A 12: 104,702,818 Q1202* probably null Het
Disp1 C T 1: 183,087,587 V1090M probably damaging Het
Dnajc28 T C 16: 91,617,170 D62G possibly damaging Het
Dock1 C T 7: 134,772,323 T566I probably benign Het
Dopey1 T G 9: 86,521,193 M18R possibly damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab3 A T 11: 105,106,449 D155V probably benign Het
Ehmt2 T C 17: 34,905,927 S465P possibly damaging Het
Eno1b G A 18: 48,047,658 W301* probably null Het
Fam49a G T 12: 12,362,027 A150S possibly damaging Het
Fpgt A G 3: 155,087,266 S375P probably benign Het
Gas2l1 G A 11: 5,061,785 S348F possibly damaging Het
Gm16486 A G 8: 70,708,575 E139G probably benign Het
Ice1 A T 13: 70,603,732 C1412S probably damaging Het
Klhl2 A C 8: 64,758,223 L264V probably damaging Het
Lars2 A G 9: 123,459,497 T803A probably benign Het
Ldb2 T A 5: 44,480,270 K232M probably damaging Het
Lix1 G A 17: 17,443,676 R92Q probably damaging Het
Meig1 C T 2: 3,409,203 V87I not run Het
Mitf A C 6: 97,993,298 S176R probably damaging Het
Myh7 A G 14: 54,990,941 V236A probably benign Het
Myo5a T A 9: 75,122,957 Y119* probably null Het
Ncapg2 A G 12: 116,426,577 N382S probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr753-ps1 A G 17: 37,169,901 F147S probably damaging Het
Osbpl5 C T 7: 143,702,724 R454Q probably benign Het
Panx1 A G 9: 15,045,001 S13P possibly damaging Het
Pde2a A G 7: 101,503,972 D413G probably benign Het
Plcb1 A T 2: 135,346,396 Y803F probably benign Het
Pth2r T A 1: 65,343,501 Y143N possibly damaging Het
Ptpn4 C T 1: 119,691,600 probably null Het
Rapgef3 T C 15: 97,761,520 Y112C probably benign Het
Rusc2 A G 4: 43,422,492 N907S probably damaging Het
Scn7a T A 2: 66,692,594 N922I probably damaging Het
Shprh T C 10: 11,212,333 V1620A possibly damaging Het
Slc25a54 T A 3: 109,111,045 S280R probably damaging Het
Slc30a5 T C 13: 100,828,911 I63M probably damaging Het
Smg1 A T 7: 118,152,387 V2817E unknown Het
Sprr3 T C 3: 92,456,877 E220G probably damaging Het
Tcf21 T C 10: 22,819,863 E14G probably benign Het
Tenm4 A G 7: 96,852,456 D1289G probably damaging Het
Tmem121b C A 6: 120,492,103 G551V probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Trib1 T C 15: 59,651,555 I146T probably damaging Het
Ttc32 T A 12: 9,034,953 Y58N probably damaging Het
Vcan T A 13: 89,657,290 I3336L probably benign Het
Vmn1r200 C A 13: 22,395,283 Y85* probably null Het
Vps39 T C 2: 120,344,211 I97V probably benign Het
Zan T A 5: 137,436,631 I2167F unknown Het
Zfp37 A T 4: 62,191,428 Y507* probably null Het
Zfp39 A G 11: 58,902,747 V55A probably benign Het
Zfp616 A T 11: 74,083,514 N294I possibly damaging Het
Zfp729a T C 13: 67,620,089 T674A probably benign Het
Other mutations in Dopey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dopey2 APN 16 93800026 unclassified probably benign
IGL00492:Dopey2 APN 16 93780782 missense probably benign 0.00
IGL00753:Dopey2 APN 16 93769624 missense probably benign
IGL00832:Dopey2 APN 16 93763401 missense probably benign 0.01
IGL00939:Dopey2 APN 16 93774083 missense possibly damaging 0.83
IGL01019:Dopey2 APN 16 93810229 missense probably benign 0.32
IGL01288:Dopey2 APN 16 93739293 missense possibly damaging 0.78
IGL01505:Dopey2 APN 16 93757116 missense possibly damaging 0.87
IGL01535:Dopey2 APN 16 93769958 nonsense probably null
IGL01696:Dopey2 APN 16 93770240 missense probably benign 0.00
IGL02077:Dopey2 APN 16 93780760 missense probably damaging 0.96
IGL02163:Dopey2 APN 16 93762427 missense possibly damaging 0.48
IGL02234:Dopey2 APN 16 93752151 missense probably benign
IGL02302:Dopey2 APN 16 93810117 missense probably benign 0.08
IGL02485:Dopey2 APN 16 93770822 missense probably damaging 1.00
IGL02563:Dopey2 APN 16 93777405 missense probably damaging 0.99
IGL02733:Dopey2 APN 16 93739191 missense possibly damaging 0.80
IGL02792:Dopey2 APN 16 93801572 missense possibly damaging 0.75
IGL02941:Dopey2 APN 16 93755473 missense probably benign 0.09
IGL03143:Dopey2 APN 16 93759655 missense probably benign
PIT4519001:Dopey2 UTSW 16 93762054 missense probably benign
R0320:Dopey2 UTSW 16 93810147 missense probably benign 0.02
R0499:Dopey2 UTSW 16 93770437 missense probably benign 0.00
R0501:Dopey2 UTSW 16 93752862 missense probably benign 0.00
R0534:Dopey2 UTSW 16 93762505 missense probably benign 0.04
R0583:Dopey2 UTSW 16 93755486 missense probably benign 0.30
R0626:Dopey2 UTSW 16 93763956 missense probably damaging 1.00
R0724:Dopey2 UTSW 16 93762325 missense probably benign 0.01
R0907:Dopey2 UTSW 16 93801593 missense probably damaging 1.00
R1263:Dopey2 UTSW 16 93777386 missense probably benign
R1378:Dopey2 UTSW 16 93770392 missense probably benign
R1572:Dopey2 UTSW 16 93770153 missense probably damaging 1.00
R1604:Dopey2 UTSW 16 93762570 missense probably benign
R1642:Dopey2 UTSW 16 93762315 missense probably benign 0.00
R1668:Dopey2 UTSW 16 93765516 missense probably damaging 1.00
R1669:Dopey2 UTSW 16 93769660 missense probably damaging 1.00
R1702:Dopey2 UTSW 16 93747621 missense possibly damaging 0.47
R1711:Dopey2 UTSW 16 93799926 missense probably damaging 1.00
R1917:Dopey2 UTSW 16 93716262 missense probably damaging 1.00
R1968:Dopey2 UTSW 16 93782419 missense probably damaging 1.00
R1988:Dopey2 UTSW 16 93766173 missense probably damaging 1.00
R2029:Dopey2 UTSW 16 93769435 missense probably benign 0.36
R2139:Dopey2 UTSW 16 93771007 missense possibly damaging 0.78
R2355:Dopey2 UTSW 16 93770677 missense probably damaging 1.00
R3609:Dopey2 UTSW 16 93739332 missense probably damaging 1.00
R3792:Dopey2 UTSW 16 93771846 missense possibly damaging 0.54
R4364:Dopey2 UTSW 16 93770924 missense probably benign 0.00
R4380:Dopey2 UTSW 16 93716232 missense possibly damaging 0.53
R4455:Dopey2 UTSW 16 93766215 missense probably damaging 1.00
R4779:Dopey2 UTSW 16 93757081 missense probably damaging 1.00
R4820:Dopey2 UTSW 16 93793090 missense probably benign 0.00
R4834:Dopey2 UTSW 16 93740004 start codon destroyed probably null 0.70
R4866:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R4882:Dopey2 UTSW 16 93752914 missense possibly damaging 0.95
R4900:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R5153:Dopey2 UTSW 16 93774003 missense probably damaging 0.98
R5176:Dopey2 UTSW 16 93740043 missense probably damaging 1.00
R5206:Dopey2 UTSW 16 93801584 missense probably damaging 1.00
R5320:Dopey2 UTSW 16 93739986 missense probably damaging 1.00
R5361:Dopey2 UTSW 16 93770504 missense probably damaging 1.00
R5380:Dopey2 UTSW 16 93763410 missense probably damaging 0.96
R5476:Dopey2 UTSW 16 93773913 splice site probably null
R5502:Dopey2 UTSW 16 93793226 missense probably benign 0.00
R5543:Dopey2 UTSW 16 93798920 missense probably damaging 0.98
R5557:Dopey2 UTSW 16 93763931 missense probably damaging 0.96
R5901:Dopey2 UTSW 16 93769751 missense possibly damaging 0.88
R5907:Dopey2 UTSW 16 93801581 missense probably damaging 1.00
R6174:Dopey2 UTSW 16 93766222 missense probably damaging 1.00
R6256:Dopey2 UTSW 16 93807214 missense possibly damaging 0.94
R6383:Dopey2 UTSW 16 93782248 missense possibly damaging 0.76
R6525:Dopey2 UTSW 16 93809416 missense probably damaging 1.00
R6554:Dopey2 UTSW 16 93760458 missense probably benign 0.22
R6823:Dopey2 UTSW 16 93755485 missense possibly damaging 0.75
R7036:Dopey2 UTSW 16 93777490 missense probably benign 0.01
R7058:Dopey2 UTSW 16 93776990 missense probably benign 0.00
R7061:Dopey2 UTSW 16 93762063 missense probably benign 0.00
R7209:Dopey2 UTSW 16 93769845 missense probably benign
R7214:Dopey2 UTSW 16 93810135 missense possibly damaging 0.69
R7232:Dopey2 UTSW 16 93760485 critical splice donor site probably null
R7255:Dopey2 UTSW 16 93770146 missense probably damaging 1.00
R7335:Dopey2 UTSW 16 93747508 missense probably benign 0.04
R7535:Dopey2 UTSW 16 93806361 missense probably damaging 1.00
R7763:Dopey2 UTSW 16 93755514 missense probably benign 0.00
R7814:Dopey2 UTSW 16 93799971 missense probably damaging 1.00
R7839:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7862:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7894:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R7922:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7945:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7977:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R8033:Dopey2 UTSW 16 93769483 missense probably benign
R8067:Dopey2 UTSW 16 93765448 nonsense probably null
Z1088:Dopey2 UTSW 16 93763326 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93769581 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93803546 missense probably damaging 1.00
Z1176:Dopey2 UTSW 16 93807868 missense possibly damaging 0.82
Z1177:Dopey2 UTSW 16 93763895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCCTCTTGACAGCTATC -3'
(R):5'- GCTGCAGATAACCATAGCTCCC -3'

Sequencing Primer
(F):5'- TGGATGGTTAAGTAAAGCCACATGTC -3'
(R):5'- TAGCTCCCGTAAGAGTTCAATC -3'
Posted On2020-01-23