Mutagenetix > Incidental Mutation

Incidental Mutation 'R8061:Dsc2'

619742

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8061 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20032274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 881 (G881R)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably benign
Transcript: ENSMUST00000039247

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Meta Mutation Damage Score

0.1423

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	A	G	9: 8,042,671	W37R	probably damaging	Het
Acads	G	A	5: 115,117,651	R42C	probably benign	Het
Agrn	G	A	4: 156,178,954	R338C	probably damaging	Het
Anapc1	T	C	2: 128,648,488	E1008G	probably damaging	Het
Art5	A	T	7: 102,098,249	Y108N	possibly damaging	Het
As3mt	G	A	19: 46,740,543	C369Y	probably damaging	Het
Asb3	A	G	11: 30,998,447	N41S	probably damaging	Het
Astn1	G	A	1: 158,504,350		probably null	Het
Asxl3	T	A	18: 22,524,243	M1770K	possibly damaging	Het
Atp8b2	T	C	3: 89,946,220		probably benign	Het
Chrm1	T	C	19: 8,679,154	Y408H	possibly damaging	Het
Chst2	T	C	9: 95,405,171	H374R	probably damaging	Het
Cnot1	A	G	8: 95,765,027	F390L	possibly damaging	Het
Comt	T	C	16: 18,411,290	Y100C	probably benign	Het
Dclk2	T	C	3: 86,813,674		probably benign	Het
Dicer1	G	A	12: 104,702,818	Q1202*	probably null	Het
Disp1	C	T	1: 183,087,587	V1090M	probably damaging	Het
Dnajc28	T	C	16: 91,617,170	D62G	possibly damaging	Het
Dock1	C	T	7: 134,772,323	T566I	probably benign	Het
Dopey1	T	G	9: 86,521,193	M18R	possibly damaging	Het
Dopey2	T	C	16: 93,749,996	L296P	probably damaging	Het
Efcab3	A	T	11: 105,106,449	D155V	probably benign	Het
Ehmt2	T	C	17: 34,905,927	S465P	possibly damaging	Het
Eno1b	G	A	18: 48,047,658	W301*	probably null	Het
Fam49a	G	T	12: 12,362,027	A150S	possibly damaging	Het
Fpgt	A	G	3: 155,087,266	S375P	probably benign	Het
Gas2l1	G	A	11: 5,061,785	S348F	possibly damaging	Het
Gen1	A	T	12: 11,261,076		probably benign	Het
Gm16486	A	G	8: 70,708,575	E139G	probably benign	Het
Ice1	A	T	13: 70,603,732	C1412S	probably damaging	Het
Klhl2	A	C	8: 64,758,223	L264V	probably damaging	Het
Lars2	A	G	9: 123,459,497	T803A	probably benign	Het
Ldb2	T	A	5: 44,480,270	K232M	probably damaging	Het
Lix1	G	A	17: 17,443,676	R92Q	probably damaging	Het
Meig1	C	T	2: 3,409,203	V87I	not run	Het
Mitf	A	C	6: 97,993,298	S176R	probably damaging	Het
Myh7	A	G	14: 54,990,941	V236A	probably benign	Het
Myo5a	T	A	9: 75,122,957	Y119*	probably null	Het
Ncapg2	A	G	12: 116,426,577	N382S	probably benign	Het
Neu2	C	T	1: 87,596,911	P206L	probably damaging	Het
Olfr753-ps1	A	G	17: 37,169,901	F147S	probably damaging	Het
Osbpl5	C	T	7: 143,702,724	R454Q	probably benign	Het
Panx1	A	G	9: 15,045,001	S13P	possibly damaging	Het
Pde2a	A	G	7: 101,503,972	D413G	probably benign	Het
Plcb1	A	T	2: 135,346,396	Y803F	probably benign	Het
Prrc2a	T	C	17: 35,161,186		probably benign	Het
Pth2r	T	A	1: 65,343,501	Y143N	possibly damaging	Het
Ptpn4	C	T	1: 119,691,600		probably null	Het
Rapgef3	T	C	15: 97,761,520	Y112C	probably benign	Het
Rusc2	A	G	4: 43,422,492	N907S	probably damaging	Het
Scn7a	T	A	2: 66,692,594	N922I	probably damaging	Het
Shprh	T	C	10: 11,212,333	V1620A	possibly damaging	Het
Slc25a54	T	A	3: 109,111,045	S280R	probably damaging	Het
Slc30a5	T	C	13: 100,828,911	I63M	probably damaging	Het
Smg1	A	T	7: 118,152,387	V2817E	unknown	Het
Sprr3	T	C	3: 92,456,877	E220G	probably damaging	Het
Tcf21	T	C	10: 22,819,863	E14G	probably benign	Het
Tenm4	A	G	7: 96,852,456	D1289G	probably damaging	Het
Tmem121b	C	A	6: 120,492,103	G551V	probably damaging	Het
Tpk1	A	G	6: 43,346,844	S224P	probably damaging	Het
Trib1	T	C	15: 59,651,555	I146T	probably damaging	Het
Ttc32	T	A	12: 9,034,953	Y58N	probably damaging	Het
Vcan	T	A	13: 89,657,290	I3336L	probably benign	Het
Vmn1r200	C	A	13: 22,395,283	Y85*	probably null	Het
Vps39	T	C	2: 120,344,211	I97V	probably benign	Het
Zan	T	A	5: 137,436,631	I2167F	unknown	Het
Zfp37	A	T	4: 62,191,428	Y507*	probably null	Het
Zfp39	A	G	11: 58,902,747	V55A	probably benign	Het
Zfp616	A	T	11: 74,083,514	N294I	possibly damaging	Het
Zfp729a	T	C	13: 67,620,089	T674A	probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGATTCTGCAGACCGAGATAG -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- TTCTGCAGACCGAGATAGGAGAG -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'

Posted On

2020-01-23