Mutagenetix > Incidental Mutation

Incidental Mutation 'R8061:Asxl3'

619743

Institutional Source

Beutler Lab

Gene Symbol

Asxl3

Ensembl Gene

ENSMUSG00000045215

Gene Name

additional sex combs like 3, transcriptional regulator

Synonyms

D930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.380) question?

Stock #

R8061 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22344883-22530227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22524243 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1770 (M1770K)

Ref Sequence

ENSEMBL: ENSMUSP00000095260 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097655
AA Change: M1770K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: M1770K

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	173	305	5.6e-50	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2139	2202	9.8e-28	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120223
AA Change: M1770K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: M1770K

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	179	304	1.3e-36	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2138	2202	1.9e-24	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (70/70)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	A	G	9: 8,042,671	W37R	probably damaging	Het
Acads	G	A	5: 115,117,651	R42C	probably benign	Het
Agrn	G	A	4: 156,178,954	R338C	probably damaging	Het
Anapc1	T	C	2: 128,648,488	E1008G	probably damaging	Het
Art5	A	T	7: 102,098,249	Y108N	possibly damaging	Het
As3mt	G	A	19: 46,740,543	C369Y	probably damaging	Het
Asb3	A	G	11: 30,998,447	N41S	probably damaging	Het
Astn1	G	A	1: 158,504,350		probably null	Het
Atp8b2	T	C	3: 89,946,220		probably benign	Het
Chrm1	T	C	19: 8,679,154	Y408H	possibly damaging	Het
Chst2	T	C	9: 95,405,171	H374R	probably damaging	Het
Cnot1	A	G	8: 95,765,027	F390L	possibly damaging	Het
Comt	T	C	16: 18,411,290	Y100C	probably benign	Het
Dclk2	T	C	3: 86,813,674		probably benign	Het
Dicer1	G	A	12: 104,702,818	Q1202*	probably null	Het
Disp1	C	T	1: 183,087,587	V1090M	probably damaging	Het
Dnajc28	T	C	16: 91,617,170	D62G	possibly damaging	Het
Dock1	C	T	7: 134,772,323	T566I	probably benign	Het
Dopey1	T	G	9: 86,521,193	M18R	possibly damaging	Het
Dopey2	T	C	16: 93,749,996	L296P	probably damaging	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab3	A	T	11: 105,106,449	D155V	probably benign	Het
Ehmt2	T	C	17: 34,905,927	S465P	possibly damaging	Het
Eno1b	G	A	18: 48,047,658	W301*	probably null	Het
Fam49a	G	T	12: 12,362,027	A150S	possibly damaging	Het
Fpgt	A	G	3: 155,087,266	S375P	probably benign	Het
Gas2l1	G	A	11: 5,061,785	S348F	possibly damaging	Het
Gen1	A	T	12: 11,261,076		probably benign	Het
Gm16486	A	G	8: 70,708,575	E139G	probably benign	Het
Ice1	A	T	13: 70,603,732	C1412S	probably damaging	Het
Klhl2	A	C	8: 64,758,223	L264V	probably damaging	Het
Lars2	A	G	9: 123,459,497	T803A	probably benign	Het
Ldb2	T	A	5: 44,480,270	K232M	probably damaging	Het
Lix1	G	A	17: 17,443,676	R92Q	probably damaging	Het
Meig1	C	T	2: 3,409,203	V87I	not run	Het
Mitf	A	C	6: 97,993,298	S176R	probably damaging	Het
Myh7	A	G	14: 54,990,941	V236A	probably benign	Het
Myo5a	T	A	9: 75,122,957	Y119*	probably null	Het
Ncapg2	A	G	12: 116,426,577	N382S	probably benign	Het
Neu2	C	T	1: 87,596,911	P206L	probably damaging	Het
Olfr753-ps1	A	G	17: 37,169,901	F147S	probably damaging	Het
Osbpl5	C	T	7: 143,702,724	R454Q	probably benign	Het
Panx1	A	G	9: 15,045,001	S13P	possibly damaging	Het
Pde2a	A	G	7: 101,503,972	D413G	probably benign	Het
Plcb1	A	T	2: 135,346,396	Y803F	probably benign	Het
Prrc2a	T	C	17: 35,161,186		probably benign	Het
Pth2r	T	A	1: 65,343,501	Y143N	possibly damaging	Het
Ptpn4	C	T	1: 119,691,600		probably null	Het
Rapgef3	T	C	15: 97,761,520	Y112C	probably benign	Het
Rusc2	A	G	4: 43,422,492	N907S	probably damaging	Het
Scn7a	T	A	2: 66,692,594	N922I	probably damaging	Het
Shprh	T	C	10: 11,212,333	V1620A	possibly damaging	Het
Slc25a54	T	A	3: 109,111,045	S280R	probably damaging	Het
Slc30a5	T	C	13: 100,828,911	I63M	probably damaging	Het
Smg1	A	T	7: 118,152,387	V2817E	unknown	Het
Sprr3	T	C	3: 92,456,877	E220G	probably damaging	Het
Tcf21	T	C	10: 22,819,863	E14G	probably benign	Het
Tenm4	A	G	7: 96,852,456	D1289G	probably damaging	Het
Tmem121b	C	A	6: 120,492,103	G551V	probably damaging	Het
Tpk1	A	G	6: 43,346,844	S224P	probably damaging	Het
Trib1	T	C	15: 59,651,555	I146T	probably damaging	Het
Ttc32	T	A	12: 9,034,953	Y58N	probably damaging	Het
Vcan	T	A	13: 89,657,290	I3336L	probably benign	Het
Vmn1r200	C	A	13: 22,395,283	Y85*	probably null	Het
Vps39	T	C	2: 120,344,211	I97V	probably benign	Het
Zan	T	A	5: 137,436,631	I2167F	unknown	Het
Zfp37	A	T	4: 62,191,428	Y507*	probably null	Het
Zfp39	A	G	11: 58,902,747	V55A	probably benign	Het
Zfp616	A	T	11: 74,083,514	N294I	possibly damaging	Het
Zfp729a	T	C	13: 67,620,089	T674A	probably benign	Het

Other mutations in Asxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Asxl3	APN	18	22525223	missense	probably benign	0.41
IGL00510:Asxl3	APN	18	22523565	missense	probably damaging	1.00
IGL00864:Asxl3	APN	18	22522446	missense	probably benign	0.06
IGL01074:Asxl3	APN	18	22522845	missense	probably damaging	1.00
IGL01305:Asxl3	APN	18	22516446	missense	probably benign	0.06
IGL01313:Asxl3	APN	18	22517459	missense	probably benign	0.41
IGL01349:Asxl3	APN	18	22524237	missense	probably benign	0.28
IGL01529:Asxl3	APN	18	22517655	missense	probably damaging	1.00
IGL01574:Asxl3	APN	18	22523564	missense	probably benign	0.06
IGL01583:Asxl3	APN	18	22516597	missense	probably benign	0.01
IGL01619:Asxl3	APN	18	22523328	missense	probably damaging	1.00
IGL01720:Asxl3	APN	18	22525325	missense	probably damaging	1.00
IGL01816:Asxl3	APN	18	22522488	missense	probably benign	0.10
IGL01828:Asxl3	APN	18	22525558	utr 3 prime	probably benign
IGL01903:Asxl3	APN	18	22434576	missense	probably benign	0.00
IGL01906:Asxl3	APN	18	22522281	missense	probably benign	0.01
IGL01962:Asxl3	APN	18	22522445	missense	probably benign	0.00
IGL01991:Asxl3	APN	18	22516162	missense	probably damaging	1.00
IGL02064:Asxl3	APN	18	22524344	missense	possibly damaging	0.59
IGL02187:Asxl3	APN	18	22524978	missense	probably damaging	0.99
IGL02219:Asxl3	APN	18	22453626	missense	possibly damaging	0.81
IGL02309:Asxl3	APN	18	22522453	missense	probably benign	0.01
IGL02478:Asxl3	APN	18	22523013	missense	possibly damaging	0.77
IGL02506:Asxl3	APN	18	22452399	missense	probably benign	0.19
IGL02660:Asxl3	APN	18	22524345	missense	probably damaging	0.98
IGL02828:Asxl3	APN	18	22524661	missense	possibly damaging	0.87
IGL02863:Asxl3	APN	18	22523484	missense	probably benign	0.01
IGL03001:Asxl3	APN	18	22517398	missense	probably damaging	1.00
IGL03143:Asxl3	APN	18	22522974	missense	probably benign	0.43
ANU22:Asxl3	UTSW	18	22516446	missense	probably benign	0.06
BB001:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
BB011:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R0145:Asxl3	UTSW	18	22453605	missense	probably damaging	1.00
R0201:Asxl3	UTSW	18	22523154	missense	probably benign
R0207:Asxl3	UTSW	18	22411496	splice site	probably benign
R0230:Asxl3	UTSW	18	22452326	splice site	probably benign
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0344:Asxl3	UTSW	18	22517611	missense	probably benign	0.00
R0519:Asxl3	UTSW	18	22523520	missense	possibly damaging	0.85
R0520:Asxl3	UTSW	18	22522986	missense	probably damaging	0.96
R0548:Asxl3	UTSW	18	22521792	splice site	probably benign
R0626:Asxl3	UTSW	18	22522880	missense	probably benign	0.02
R0711:Asxl3	UTSW	18	22524451	missense	probably benign	0.01
R0744:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R0833:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R1035:Asxl3	UTSW	18	22525049	missense	probably damaging	1.00
R1170:Asxl3	UTSW	18	22524507	missense	probably benign	0.00
R1372:Asxl3	UTSW	18	22410009	missense	probably benign	0.00
R1440:Asxl3	UTSW	18	22525224	missense	probably benign	0.13
R1463:Asxl3	UTSW	18	22516753	missense	possibly damaging	0.94
R1471:Asxl3	UTSW	18	22516354	missense	probably damaging	1.00
R1618:Asxl3	UTSW	18	22516987	missense	probably damaging	1.00
R1720:Asxl3	UTSW	18	22452435	missense	probably damaging	1.00
R1819:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R1824:Asxl3	UTSW	18	22522068	missense	probably damaging	1.00
R1851:Asxl3	UTSW	18	22517739	missense	probably damaging	0.97
R1989:Asxl3	UTSW	18	22452363	missense	probably damaging	1.00
R2041:Asxl3	UTSW	18	22523451	missense	probably benign	0.02
R2174:Asxl3	UTSW	18	22453644	missense	possibly damaging	0.76
R2175:Asxl3	UTSW	18	22516595	missense	probably benign
R2443:Asxl3	UTSW	18	22411539	missense	probably benign	0.12
R2907:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R4246:Asxl3	UTSW	18	22525500	missense	probably damaging	1.00
R4254:Asxl3	UTSW	18	22524366	missense	possibly damaging	0.58
R4441:Asxl3	UTSW	18	22524233	missense	probably damaging	0.97
R4660:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4661:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4674:Asxl3	UTSW	18	22517738	missense	probably damaging	1.00
R4749:Asxl3	UTSW	18	22516769	missense	probably damaging	0.99
R4817:Asxl3	UTSW	18	22525454	missense	probably damaging	0.97
R4935:Asxl3	UTSW	18	22523312	missense	probably benign	0.06
R5062:Asxl3	UTSW	18	22522718	missense	possibly damaging	0.92
R5064:Asxl3	UTSW	18	22516019	missense	probably benign	0.00
R5065:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5066:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5067:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5133:Asxl3	UTSW	18	22516708	missense	probably damaging	1.00
R5174:Asxl3	UTSW	18	22523115	missense	probably benign	0.45
R5183:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5294:Asxl3	UTSW	18	22516439	missense	possibly damaging	0.77
R5416:Asxl3	UTSW	18	22524494	missense	probably damaging	1.00
R5587:Asxl3	UTSW	18	22525247	missense	probably benign	0.28
R5873:Asxl3	UTSW	18	22516085	missense	probably benign	0.04
R6240:Asxl3	UTSW	18	22465508	missense	probably damaging	1.00
R6242:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R6316:Asxl3	UTSW	18	22522782	missense	probably damaging	1.00
R6348:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R6518:Asxl3	UTSW	18	22516340	missense	probably damaging	0.96
R6605:Asxl3	UTSW	18	22517077	nonsense	probably null
R6704:Asxl3	UTSW	18	22517305	missense	probably benign	0.00
R6706:Asxl3	UTSW	18	22453609	missense	probably damaging	1.00
R6786:Asxl3	UTSW	18	22525440	missense	probably damaging	1.00
R6799:Asxl3	UTSW	18	22465400	nonsense	probably null
R6811:Asxl3	UTSW	18	22522911	missense	possibly damaging	0.87
R6817:Asxl3	UTSW	18	22523580	missense	probably benign	0.00
R6830:Asxl3	UTSW	18	22525388	missense	probably benign	0.45
R6957:Asxl3	UTSW	18	22522091	missense	probably damaging	1.00
R7015:Asxl3	UTSW	18	22523921	missense	probably benign	0.00
R7058:Asxl3	UTSW	18	22517674	missense	probably damaging	1.00
R7135:Asxl3	UTSW	18	22517701	nonsense	probably null
R7135:Asxl3	UTSW	18	22517702	missense	probably damaging	1.00
R7231:Asxl3	UTSW	18	22411499	critical splice acceptor site	probably null
R7231:Asxl3	UTSW	18	22517540	missense	probably damaging	1.00
R7431:Asxl3	UTSW	18	22516953	missense	probably damaging	1.00
R7851:Asxl3	UTSW	18	22517222	missense	possibly damaging	0.62
R7871:Asxl3	UTSW	18	22524224	missense	not run
R7880:Asxl3	UTSW	18	22522151	missense	possibly damaging	0.90
R7924:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R8115:Asxl3	UTSW	18	22517585	missense	probably damaging	0.99
R8174:Asxl3	UTSW	18	22517743	missense	probably benign	0.02
R8303:Asxl3	UTSW	18	22524416	missense	probably benign
R8360:Asxl3	UTSW	18	22516117	missense	probably benign
R8547:Asxl3	UTSW	18	22522772	missense	probably benign	0.04
R8699:Asxl3	UTSW	18	22434607	missense	probably benign	0.02
R8774:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8774-TAIL:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8867:Asxl3	UTSW	18	22516490	missense	possibly damaging	0.87
R8915:Asxl3	UTSW	18	22524706	missense	probably benign	0.00
R8954:Asxl3	UTSW	18	22517750	missense	probably damaging	1.00
R9031:Asxl3	UTSW	18	22524344	missense	probably damaging	0.96
R9047:Asxl3	UTSW	18	22452408	missense	probably damaging	1.00
R9047:Asxl3	UTSW	18	22452414	missense	probably damaging	1.00
R9135:Asxl3	UTSW	18	22516613	missense	probably damaging	0.99
R9135:Asxl3	UTSW	18	22524424	missense	possibly damaging	0.89
R9210:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9212:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9285:Asxl3	UTSW	18	22521932	missense	probably damaging	1.00
R9572:Asxl3	UTSW	18	22516055	missense	probably benign	0.25
R9707:Asxl3	UTSW	18	22523247	missense	probably benign	0.01
R9768:Asxl3	UTSW	18	22517044	missense	probably benign	0.00
R9784:Asxl3	UTSW	18	22517254	missense	probably benign
Z1088:Asxl3	UTSW	18	22516772	missense	probably benign	0.00
Z1176:Asxl3	UTSW	18	22522220	missense	probably damaging	1.00
Z1177:Asxl3	UTSW	18	22516339	missense	probably benign	0.00
Z1177:Asxl3	UTSW	18	22523591	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAAGCTAATAACCCACTGG -3'
(R):5'- GCCGTTCCTGCTTAAATGGC -3'

Sequencing Primer
(F):5'- ACTGGTGACACAGCTACTGCAG -3'
(R):5'- CTGGTTGTGTCCTAGCTGACTC -3'

Posted On

2020-01-23