Incidental Mutation 'R8061:As3mt'
ID619746
Institutional Source Beutler Lab
Gene Symbol As3mt
Ensembl Gene ENSMUSG00000003559
Gene Namearsenic (+3 oxidation state) methyltransferase
Synonyms2310045H08Rik, Cyt19
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8061 (G1)
Quality Score220.009
Status Validated
Chromosome19
Chromosomal Location46707443-46741095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46740543 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 369 (C369Y)
Ref Sequence ENSEMBL: ENSMUSP00000003655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003655]
Predicted Effect probably damaging
Transcript: ENSMUST00000003655
AA Change: C369Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003655
Gene: ENSMUSG00000003559
AA Change: C369Y

DomainStartEndE-ValueType
Pfam:Methyltransf_23 34 227 2.5e-14 PFAM
Pfam:PCMT 64 183 7.7e-9 PFAM
Pfam:Ubie_methyltran 64 196 8.9e-16 PFAM
Pfam:PrmA 65 193 1.8e-6 PFAM
Pfam:Methyltransf_31 70 243 2e-36 PFAM
Pfam:Methyltransf_18 71 187 9.7e-14 PFAM
Pfam:Methyltransf_25 75 180 2.8e-15 PFAM
Pfam:Methyltransf_12 76 182 2.9e-14 PFAM
Pfam:Methyltransf_11 76 184 2.7e-19 PFAM
low complexity region 297 310 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AS3MT catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (AdoMet) to trivalent arsenical and may play a role in arsenic metabolism (Lin et al., 2002 [PubMed 11790780]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormalities in arsenic methylation and in the distribution/retention of orally administered arsenate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A G 9: 8,042,671 W37R probably damaging Het
Acads G A 5: 115,117,651 R42C probably benign Het
Agrn G A 4: 156,178,954 R338C probably damaging Het
Anapc1 T C 2: 128,648,488 E1008G probably damaging Het
Art5 A T 7: 102,098,249 Y108N possibly damaging Het
Asb3 A G 11: 30,998,447 N41S probably damaging Het
Astn1 G A 1: 158,504,350 probably null Het
Asxl3 T A 18: 22,524,243 M1770K possibly damaging Het
Atp8b2 T C 3: 89,946,220 probably benign Het
Chrm1 T C 19: 8,679,154 Y408H possibly damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cnot1 A G 8: 95,765,027 F390L possibly damaging Het
Comt T C 16: 18,411,290 Y100C probably benign Het
Dclk2 T C 3: 86,813,674 probably benign Het
Dicer1 G A 12: 104,702,818 Q1202* probably null Het
Disp1 C T 1: 183,087,587 V1090M probably damaging Het
Dnajc28 T C 16: 91,617,170 D62G possibly damaging Het
Dock1 C T 7: 134,772,323 T566I probably benign Het
Dopey1 T G 9: 86,521,193 M18R possibly damaging Het
Dopey2 T C 16: 93,749,996 L296P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab3 A T 11: 105,106,449 D155V probably benign Het
Ehmt2 T C 17: 34,905,927 S465P possibly damaging Het
Eno1b G A 18: 48,047,658 W301* probably null Het
Fam49a G T 12: 12,362,027 A150S possibly damaging Het
Fpgt A G 3: 155,087,266 S375P probably benign Het
Gas2l1 G A 11: 5,061,785 S348F possibly damaging Het
Gen1 A T 12: 11,261,076 probably benign Het
Gm16486 A G 8: 70,708,575 E139G probably benign Het
Ice1 A T 13: 70,603,732 C1412S probably damaging Het
Klhl2 A C 8: 64,758,223 L264V probably damaging Het
Lars2 A G 9: 123,459,497 T803A probably benign Het
Ldb2 T A 5: 44,480,270 K232M probably damaging Het
Lix1 G A 17: 17,443,676 R92Q probably damaging Het
Meig1 C T 2: 3,409,203 V87I not run Het
Mitf A C 6: 97,993,298 S176R probably damaging Het
Myh7 A G 14: 54,990,941 V236A probably benign Het
Myo5a T A 9: 75,122,957 Y119* probably null Het
Ncapg2 A G 12: 116,426,577 N382S probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr753-ps1 A G 17: 37,169,901 F147S probably damaging Het
Osbpl5 C T 7: 143,702,724 R454Q probably benign Het
Panx1 A G 9: 15,045,001 S13P possibly damaging Het
Pde2a A G 7: 101,503,972 D413G probably benign Het
Plcb1 A T 2: 135,346,396 Y803F probably benign Het
Prrc2a T C 17: 35,161,186 probably benign Het
Pth2r T A 1: 65,343,501 Y143N possibly damaging Het
Ptpn4 C T 1: 119,691,600 probably null Het
Rapgef3 T C 15: 97,761,520 Y112C probably benign Het
Rusc2 A G 4: 43,422,492 N907S probably damaging Het
Scn7a T A 2: 66,692,594 N922I probably damaging Het
Shprh T C 10: 11,212,333 V1620A possibly damaging Het
Slc25a54 T A 3: 109,111,045 S280R probably damaging Het
Slc30a5 T C 13: 100,828,911 I63M probably damaging Het
Smg1 A T 7: 118,152,387 V2817E unknown Het
Sprr3 T C 3: 92,456,877 E220G probably damaging Het
Tcf21 T C 10: 22,819,863 E14G probably benign Het
Tenm4 A G 7: 96,852,456 D1289G probably damaging Het
Tmem121b C A 6: 120,492,103 G551V probably damaging Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Trib1 T C 15: 59,651,555 I146T probably damaging Het
Ttc32 T A 12: 9,034,953 Y58N probably damaging Het
Vcan T A 13: 89,657,290 I3336L probably benign Het
Vmn1r200 C A 13: 22,395,283 Y85* probably null Het
Vps39 T C 2: 120,344,211 I97V probably benign Het
Zan T A 5: 137,436,631 I2167F unknown Het
Zfp37 A T 4: 62,191,428 Y507* probably null Het
Zfp39 A G 11: 58,902,747 V55A probably benign Het
Zfp616 A T 11: 74,083,514 N294I possibly damaging Het
Zfp729a T C 13: 67,620,089 T674A probably benign Het
Other mutations in As3mt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:As3mt APN 19 46720425 missense probably benign 0.06
IGL00903:As3mt APN 19 46712234 missense probably benign 0.04
IGL02190:As3mt APN 19 46719945 missense probably benign 0.38
IGL03088:As3mt APN 19 46707794 missense probably damaging 1.00
PIT4791001:As3mt UTSW 19 46720349 missense probably damaging 1.00
R1797:As3mt UTSW 19 46724934 missense possibly damaging 0.92
R2157:As3mt UTSW 19 46707792 missense probably benign 0.36
R3113:As3mt UTSW 19 46715278 splice site probably benign
R3816:As3mt UTSW 19 46707777 missense probably benign 0.32
R4819:As3mt UTSW 19 46707529 unclassified probably benign
R5053:As3mt UTSW 19 46709054 missense probably damaging 1.00
R5333:As3mt UTSW 19 46708196 missense probably null 0.97
R6003:As3mt UTSW 19 46708128 missense possibly damaging 0.85
R6269:As3mt UTSW 19 46719952 missense probably damaging 1.00
R6281:As3mt UTSW 19 46724923 missense possibly damaging 0.56
R6317:As3mt UTSW 19 46724971 missense probably benign 0.01
R6803:As3mt UTSW 19 46709581 missense probably benign 0.01
R7346:As3mt UTSW 19 46720452 missense probably damaging 1.00
R8331:As3mt UTSW 19 46709006 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAAGGATGGCAGTGCTCC -3'
(R):5'- AAGTCACTCTTATTCTTAGCAGTGG -3'

Sequencing Primer
(F):5'- CAAGGGTGGACAGGGTTAACATTTTC -3'
(R):5'- ACTCTTATTCTTAGCAGTGGTCTAG -3'
Posted On2020-01-23