Incidental Mutation 'R8062:Hdlbp'
ID619748
Institutional Source Beutler Lab
Gene Symbol Hdlbp
Ensembl Gene ENSMUSG00000034088
Gene Namehigh density lipoprotein (HDL) binding protein
Synonyms1110005P14Rik, D1Ertd101e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R8062 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location93405940-93478815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93438342 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 40 (Y40H)
Ref Sequence ENSEMBL: ENSMUSP00000043047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042498] [ENSMUST00000170883] [ENSMUST00000186164] [ENSMUST00000186787] [ENSMUST00000188165] [ENSMUST00000188988] [ENSMUST00000189025] [ENSMUST00000190321]
Predicted Effect probably benign
Transcript: ENSMUST00000042498
AA Change: Y40H

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043047
Gene: ENSMUSG00000034088
AA Change: Y40H

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170883
AA Change: Y40H

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127903
Gene: ENSMUSG00000034088
AA Change: Y40H

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186164
AA Change: Y40H

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139671
Gene: ENSMUSG00000034088
AA Change: Y40H

DomainStartEndE-ValueType
KH 149 217 1.2e-17 SMART
KH 221 289 1.1e-11 SMART
KH 294 360 1.6e-14 SMART
KH 365 433 5.7e-18 SMART
KH 437 506 4.6e-14 SMART
KH 511 579 4.7e-20 SMART
KH 583 652 2e-18 SMART
KH 657 726 7.9e-15 SMART
KH 730 799 1.5e-14 SMART
KH 803 903 1.8e-18 SMART
KH 904 970 2.8e-13 SMART
KH 982 1053 2.2e-17 SMART
KH 1057 1126 2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186787
AA Change: Y40H

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139719
Gene: ENSMUSG00000034088
AA Change: Y40H

DomainStartEndE-ValueType
Blast:KH 74 140 2e-26 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000188165
Predicted Effect probably benign
Transcript: ENSMUST00000188988
AA Change: Y40H

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140946
Gene: ENSMUSG00000034088
AA Change: Y40H

DomainStartEndE-ValueType
Blast:KH 74 148 2e-28 BLAST
Pfam:KH_1 152 177 2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189025
AA Change: Y40H

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140399
Gene: ENSMUSG00000034088
AA Change: Y40H

DomainStartEndE-ValueType
Blast:KH 74 130 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190321
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds high density lipoprotein (HDL) and may function to regulate excess cholesterol levels in cells. The encoded protein also binds RNA and can induce heterochromatin formation. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 A T 8: 79,701,144 Y172N possibly damaging Het
Abhd2 T A 7: 79,325,590 M176K possibly damaging Het
Adamts14 A G 10: 61,200,361 probably null Het
Atg2a T C 19: 6,252,579 probably null Het
AW822073 G A 10: 58,223,810 A374V unknown Het
Bach2 G A 4: 32,562,937 G468E probably damaging Het
Bap1 T A 14: 31,257,508 N489K probably benign Het
Btaf1 G A 19: 36,992,465 V1180I probably benign Het
Calm5 A G 13: 3,854,405 H33R probably benign Het
Cnr1 T A 4: 33,944,707 V365E possibly damaging Het
Crym A C 7: 120,201,168 V77G probably damaging Het
Cyp2j7 T A 4: 96,215,350 E316V probably null Het
Dab2 G A 15: 6,427,341 G233D probably damaging Het
Ddx19b A T 8: 111,020,979 S108T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Duxf3 A C 10: 58,230,928 M93R probably benign Het
Duxf3 G A 10: 58,231,067 L537F probably damaging Het
Eif2s2 A G 2: 154,877,804 F182L possibly damaging Het
Erlin1 T A 19: 44,056,159 K156I probably benign Het
Gapvd1 A G 2: 34,678,114 S1413P probably benign Het
Gm1110 G A 9: 26,881,821 A553V probably damaging Het
Gm3250 C A 10: 77,782,400 C48F unknown Het
Gm3604 T C 13: 62,370,341 S68G probably damaging Het
Golga5 T A 12: 102,484,480 M464K probably benign Het
Gpr142 G A 11: 114,806,531 R301Q probably benign Het
Gria4 C T 9: 4,480,273 D392N possibly damaging Het
Grik2 T A 10: 49,240,767 T633S probably damaging Het
Gsap T A 5: 21,194,463 I54N probably damaging Het
Hyal5 C A 6: 24,876,197 T23K possibly damaging Het
Itga6 T A 2: 71,841,743 F834L probably benign Het
K230010J24Rik G A 15: 76,046,754 R508H probably benign Het
Klf1 T A 8: 84,903,299 L251Q probably benign Het
Kndc1 A G 7: 139,918,844 D558G probably benign Het
Ktn1 T A 14: 47,724,972 probably null Het
Lcmt2 A G 2: 121,140,272 V110A possibly damaging Het
Lgr4 C T 2: 110,000,937 R304C probably damaging Het
Lnpk T A 2: 74,551,063 I119L possibly damaging Het
Med13 A G 11: 86,319,438 V626A probably benign Het
Mroh9 A T 1: 163,038,975 L700M probably damaging Het
Muc4 T A 16: 32,756,749 W138R Het
Myh2 G T 11: 67,193,383 E1611* probably null Het
Myo9b T G 8: 71,321,813 S323A probably damaging Het
Olfr1086 A C 2: 86,677,066 V89G probably benign Het
Olfr1263 T A 2: 90,015,736 F269I possibly damaging Het
Olfr135 A T 17: 38,209,174 I310F probably benign Het
Olfr888 G T 9: 38,108,917 C72F probably damaging Het
P2ry13 A T 3: 59,210,282 M25K probably benign Het
Pan3 T A 5: 147,527,150 F571Y probably benign Het
Pdcd11 A G 19: 47,130,713 D1831G possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pex1 T G 5: 3,605,656 M161R probably benign Het
Piezo2 T A 18: 63,030,466 D2127V possibly damaging Het
Plod3 A T 5: 136,990,269 H336L possibly damaging Het
Pp2d1 A T 17: 53,515,770 N89K probably benign Het
Ppp4r3a A G 12: 101,041,971 S736P probably damaging Het
Prp2 C A 6: 132,600,688 Q313K unknown Het
Psma5 T G 3: 108,266,479 D90E probably benign Het
Reln G A 5: 21,971,992 T1892I probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 T G 7: 97,677,387 D1039E Het
Rtel1 A G 2: 181,340,567 D370G probably benign Het
Scyl2 T A 10: 89,654,160 N447Y probably damaging Het
Sis A T 3: 72,920,988 Y1222* probably null Het
Slc37a3 A T 6: 39,364,596 H35Q probably damaging Het
Sltm A T 9: 70,573,497 K210N unknown Het
Spata3 T C 1: 86,024,426 I134T unknown Het
Speer4d A T 5: 15,620,439 N54I possibly damaging Het
Spert A T 14: 75,592,606 I49N probably benign Het
Syne1 A G 10: 5,185,394 probably null Het
Tars A T 15: 11,388,314 F465Y possibly damaging Het
Tlr4 T G 4: 66,839,850 N293K probably benign Het
Tmprss13 C A 9: 45,328,688 T98K unknown Het
Tnfsf8 G A 4: 63,861,195 probably benign Het
Trim30b T A 7: 104,366,186 probably benign Het
Trpm1 A G 7: 64,201,941 K136E probably benign Het
Ttc6 A G 12: 57,736,978 Y1741C possibly damaging Het
Usp38 T C 8: 80,984,589 D939G probably damaging Het
Vmn1r196 T A 13: 22,293,270 N26K probably damaging Het
Vmn2r50 C A 7: 10,040,313 probably null Het
Wdr3 T A 3: 100,142,494 M773L probably benign Het
Zfp993 T G 4: 146,654,958 probably null Het
Other mutations in Hdlbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Hdlbp APN 1 93430169 missense probably benign 0.00
IGL01321:Hdlbp APN 1 93423802 missense probably damaging 1.00
IGL01387:Hdlbp APN 1 93413588 missense possibly damaging 0.91
IGL01443:Hdlbp APN 1 93431074 missense probably damaging 0.99
IGL01467:Hdlbp APN 1 93417698 splice site probably benign
IGL02223:Hdlbp APN 1 93412449 missense probably damaging 1.00
IGL02274:Hdlbp APN 1 93408507 splice site probably null
IGL02452:Hdlbp APN 1 93417511 missense probably damaging 1.00
IGL03079:Hdlbp APN 1 93413940 splice site probably benign
IGL03169:Hdlbp APN 1 93416587 missense possibly damaging 0.92
IGL03229:Hdlbp APN 1 93430187 missense probably benign 0.00
R0119:Hdlbp UTSW 1 93421337 splice site probably benign
R0432:Hdlbp UTSW 1 93425332 missense probably damaging 1.00
R0508:Hdlbp UTSW 1 93414811 critical splice donor site probably null
R0530:Hdlbp UTSW 1 93430317 unclassified probably benign
R1276:Hdlbp UTSW 1 93421101 missense probably benign 0.12
R1302:Hdlbp UTSW 1 93423385 splice site probably null
R1331:Hdlbp UTSW 1 93421131 missense probably damaging 1.00
R1537:Hdlbp UTSW 1 93417374 missense probably benign 0.01
R1623:Hdlbp UTSW 1 93423869 missense probably damaging 1.00
R1695:Hdlbp UTSW 1 93437200 missense probably damaging 1.00
R1897:Hdlbp UTSW 1 93422285 intron probably benign
R1900:Hdlbp UTSW 1 93422237 intron probably benign
R1984:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R1985:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R2066:Hdlbp UTSW 1 93421880 intron probably benign
R2277:Hdlbp UTSW 1 93408178 nonsense probably null
R2349:Hdlbp UTSW 1 93422234 intron probably benign
R3434:Hdlbp UTSW 1 93428161 missense probably benign 0.04
R3978:Hdlbp UTSW 1 93421351 missense probably damaging 1.00
R4645:Hdlbp UTSW 1 93422120 intron probably benign
R5196:Hdlbp UTSW 1 93420193 missense probably damaging 1.00
R5760:Hdlbp UTSW 1 93440777 intron probably benign
R6327:Hdlbp UTSW 1 93429464 missense possibly damaging 0.87
R6420:Hdlbp UTSW 1 93431004 missense probably damaging 1.00
R6428:Hdlbp UTSW 1 93431445 missense possibly damaging 0.91
R6468:Hdlbp UTSW 1 93417667 missense possibly damaging 0.48
R6488:Hdlbp UTSW 1 93428224 missense probably damaging 1.00
R6592:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R6920:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R7156:Hdlbp UTSW 1 93413915 missense probably damaging 1.00
R7391:Hdlbp UTSW 1 93431061 missense possibly damaging 0.93
R7457:Hdlbp UTSW 1 93428222 missense probably benign 0.04
R7498:Hdlbp UTSW 1 93413615 missense probably benign 0.00
R7554:Hdlbp UTSW 1 93437309 missense probably damaging 0.96
R7593:Hdlbp UTSW 1 93430283 missense probably benign 0.01
R7672:Hdlbp UTSW 1 93437099 missense possibly damaging 0.90
R7904:Hdlbp UTSW 1 93423370 missense probably damaging 1.00
R7987:Hdlbp UTSW 1 93423370 missense probably damaging 1.00
RF020:Hdlbp UTSW 1 93440734 missense probably benign
Z1088:Hdlbp UTSW 1 93431354 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGCTCATCAACACTGCATATTCAG -3'
(R):5'- GTCAAACACTCGGTGCTGAG -3'

Sequencing Primer
(F):5'- CTGCATATTCAGAAACCTATCAGATC -3'
(R):5'- GTGCTGAGCCTGGTGAC -3'
Posted On2020-01-23